Description Extractor

Mutalyzer Variant Description Extractor Help

The Variant Description Extractor is an experimental service!

Construction of variant descriptions accepted by the Mutalyzer Name Checker requires comparison of the reference sequence and the variant sequence and basic knowledge of the standard human sequence variant nomenclature.

The Variant Description Extractor aims to simplify the generation of HGVS variant descriptions by direct comparison of the observed sequence with the reference sequence. The Variant Description Extractor uses an algorithm, which closely follows the human approach to describe a variant. It will first find the “region of change”, and then finds the largest overlap between the original region and the region in the observed sequence. This process is repeated until the smallest description is found. This algorithm ensures that the same description will be generated every time researchers observe this variant. Its implementation also allows automation of the variant description process.

Example

• Reference sequence:
  • ATGATGATCAGATACAGTGTGATACAGGTAGTTAGACAA
• Observed sequence:
  • ATGATTTGATCAGATACATGTGATACCGGTAGTTAGGACAA
• Variant Description Extractor output:
  • Genomic description: g.[[5_6insTT;17del;26A>C;35dup]] (See Variant Descriptions for more information about the format.)

Overview of the raw variants:

Start	End	Type	Deleted	Inserted	Shift	Description
5	6	ins		TT	1	5_6insTT
17	17	del	G		0	17del
26	26	subst	A	C	0	26A>C
35	35	dup		G	1	35dup

The table above only shows nucleotides which are deleted or inserted when they need to be specified in variant descriptions.