diff --git a/topics/assembly/tutorials/vgp_workflow_training/tutorial.md b/topics/assembly/tutorials/vgp_workflow_training/tutorial.md index ed76f731b6e067..af465a87f0cb0a 100644 --- a/topics/assembly/tutorials/vgp_workflow_training/tutorial.md +++ b/topics/assembly/tutorials/vgp_workflow_training/tutorial.md @@ -102,6 +102,8 @@ The first stage of the pipeline is the generation of *k*-mer profiles of the raw # Getting the data +----- + The following steps use PacBio {HiFi} and Illumina {Hi-C} data from baker's yeast ([*Saccharomyces cerevisiae*](https://en.wikipedia.org/wiki/Saccharomyces_cerevisiae)). The tutorial represents trajectory **B** from Fig. 1 above. For this tutorial, the first step is to get the datasets from Zenodo. Specifically, we will be uploading two datasets: 1. A set of PacBio {HiFi} reads in `fasta` format @@ -187,27 +189,46 @@ Once we have imported the datasets, the next step is to import the VGP workflows # Importing workflows +----- + All analyses described in this tutorial are performed using *workflows*--chains of tools. Before we can proceed we need to import workflows into your Galaxy account. In order to do this you need to follow the instruction below. ## Workflows for this tutorial -All current assembly workflows were shown in Fig. 1 above. In this tutorial we will use only four following workflows: +All current assembly workflows were shown in Fig. 1 above. In this tutorial we will use the four workflows listed below. + +### *K*-mer profiling workflow (WF1) + +``` +https://raw.githubusercontent.com/galaxyproject/iwc/main/workflows/VGP-assembly-v2/kmer-profiling-hifi-VGP1/kmer-profiling-hifi-VGP1.ga) +``` +### Assembly (contiging) with Hi-C (WF4) + +``` +https://raw.githubusercontent.com/galaxyproject/iwc/main/workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4/Assembly-Hifi-HiC-phasing-VGP4.ga +``` +### Purge duplicate contigs (WF6) + +``` +https://github.com/galaxyproject/iwc/raw/main/workflows/VGP-assembly-v2/Purge-duplicate-contigs-VGP6/Purge-duplicate-contigs-VGP6.ga +``` +### Scaffolding with Hi-C (WF8) -*K*-mer profiling workflow (WF1) ``` -https://raw.githubusercontent.com/galaxyproject/iwc/main/workflows/VGP-assembly-v2/kmer-profiling-hifi-VGP1/kmer-profiling-hifi-VGP1.ga` +https://raw.githubusercontent.com/galaxyproject/iwc/main/workflows/VGP-assembly-v2/Scaffolding-HiC-VGP8/Scaffolding-HiC-VGP8.ga ``` +## Other ways to import workflows into Galaxy -## From DockStore +### From DockStore {% snippet faqs/galaxy/workflows_import_from_dockstore.md %} -## From WorkflowHub +### From WorkflowHub {% snippet faqs/galaxy/workflows_import_from_workflowhub.md filter="name:vgp" %} -## From GitHub +### From GitHub {% snippet faqs/galaxy/workflows_import_from_github.md %} diff --git a/topics/assembly/tutorials/vgp_workflow_training/workflows/main_workflow.ga b/topics/assembly/tutorials/vgp_workflow_training/workflows/main_workflow.ga deleted file mode 100644 index f3ea5e13ccf94b..00000000000000 --- a/topics/assembly/tutorials/vgp_workflow_training/workflows/main_workflow.ga +++ /dev/null @@ -1,3635 +0,0 @@ -{ - "a_galaxy_workflow": "true", - "annotation": "VGP assembly tutorial", - "format-version": "0.1", - "name": "VGP assembly: training workflow", - "steps": { - "0": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 0, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hi-C_dataset_F" - } - ], - "label": "Hi-C_dataset_F", - "name": "Input dataset", - "outputs": [], - "position": { - "bottom": 616.6967338793205, - "height": 27.116729736328125, - "left": 207.52415512547347, - "right": 273.5241551254735, - "top": 589.5800041429924, - "width": 66, - "x": 207.52415512547347, - "y": 589.5800041429924 - }, - "tool_id": null, - "tool_state": "{\"optional\": false}", - "tool_version": null, - "type": "data_input", - "uuid": "250984e1-5af4-47aa-a7c9-90e0abe5bd42", - "workflow_outputs": [] - }, - "1": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 1, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Hi-C_dataset_R" - } - ], - "label": "Hi-C_dataset_R", - "name": "Input dataset", - "outputs": [], - "position": { - "bottom": 736.7123505563446, - "height": 27.11669921875, - "left": 207.52415512547347, - "right": 273.5241551254735, - "top": 709.5956513375946, - "width": 66, - "x": 207.52415512547347, - "y": 709.5956513375946 - }, - "tool_id": null, - "tool_state": "{\"optional\": false}", - "tool_version": null, - "type": "data_input", - "uuid": "ee03cfe1-a698-497c-8a08-c73415b6f493", - "workflow_outputs": [] - }, - "2": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 2, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Input Dataset Collection" - } - ], - "label": "Input Dataset Collection", - "name": "Input dataset collection", - "outputs": [], - "position": { - "bottom": 1338.7279903527462, - "height": 27.11669921875, - "left": -1480.569550485322, - "right": -1414.569550485322, - "top": 1311.6112911339962, - "width": 66, - "x": -1480.569550485322, - "y": 1311.6112911339962 - }, - "tool_id": null, - "tool_state": "{\"optional\": false, \"collection_type\": \"list\"}", - "tool_version": null, - "type": "data_collection_input", - "uuid": "5390d8d6-500b-4d79-b2ea-7879f1841c68", - "workflow_outputs": [] - }, - "3": { - "annotation": "", - "content_id": null, - "errors": null, - "id": 3, - "input_connections": {}, - "inputs": [ - { - "description": "", - "name": "Bionano_dataset" - } - ], - "label": "Bionano_dataset", - "name": "Input dataset", - "outputs": [], - "position": { - "bottom": 797.6811079545454, - "height": 27.11669921875, - "left": 1925.4616477272727, - "right": 1991.4616477272727, - "top": 770.5644087357954, - "width": 66, - "x": 1925.4616477272727, - "y": 770.5644087357954 - }, - "tool_id": null, - "tool_state": "{\"optional\": false}", - "tool_version": null, - "type": "data_input", - "uuid": "52f6fc65-1b24-4a75-b9ca-fb7bfdd68ad7", - "workflow_outputs": [] - }, - "4": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/3.5+galaxy2", - "errors": null, - "id": 4, - "input_connections": { - "library|input_1": { - "id": 2, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Cutadapt", - "outputs": [ - { - "name": "out1", - "type": "fastqsanger" - } - ], - "position": { - "bottom": 1329.8157681551845, - "height": 44.20452880859375, - "left": -1202.5070652817235, - "right": -1136.5070652817235, - "top": 1285.6112393465908, - "width": 66, - "x": -1202.5070652817235, - "y": 1285.6112393465908 - }, - "post_job_actions": { - "ChangeDatatypeActionout1": { - "action_arguments": { - "newtype": "fasta" - }, - "action_type": "ChangeDatatypeAction", - "output_name": "out1" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/3.5+galaxy2", - "tool_shed_repository": { - "changeset_revision": "48f587c13075", - "name": "cutadapt", - "owner": "lparsons", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": \"false\", \"times\": \"3\", \"overlap\": \"35\", \"match_read_wildcards\": \" \", \"revcomp\": \"true\"}, \"filter_options\": {\"discard_trimmed\": \"true\", \"discard_untrimmed\": \"false\", \"minimum_length\": null, \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": \"false\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"First adaptor\", \"anywhere_adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": \"false\"}, {\"__index__\": 1, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"Second adaptor\", \"anywhere_adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": \"false\"}], \"cut\": \"0\"}}, \"output_selector\": null, \"read_mod_options\": {\"quality_cutoff\": \"0\", \"nextseq_trim\": \"0\", \"trim_n\": \"false\", \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "3.5+galaxy2", - "type": "tool", - "uuid": "1ad390d7-995e-4fdc-ae71-2617414b2526", - "workflow_outputs": [ - { - "label": null, - "output_name": "out1", - "uuid": "292c0745-9898-44b7-b70d-62cb79af24ed" - } - ] - }, - "5": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy4", - "errors": null, - "id": 5, - "input_connections": { - "operation_type|input_reads": { - "id": 4, - "output_name": "out1" - } - }, - "inputs": [], - "label": null, - "name": "Meryl", - "outputs": [ - { - "name": "read_db", - "type": "meryldb" - } - ], - "position": { - "bottom": 1333.0712825890744, - "height": 37.475616455078125, - "left": -924.5538884943181, - "right": -858.5538884943181, - "top": 1295.5956661339962, - "width": 66, - "x": -924.5538884943181, - "y": 1295.5956661339962 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy4", - "tool_shed_repository": { - "changeset_revision": "eadfd71dde37", - "name": "meryl", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input_reads|__identifier__\": \"SRR13577846_1\", \"operation_type\": {\"command_type\": \"count-kmers\", \"__current_case__\": 0, \"count_operations\": \"count\", \"input_reads\": {\"__class__\": \"ConnectedValue\"}, \"options_kmer_size\": {\"kmer_size\": \"provide\", \"__current_case__\": 0, \"input_kmer_size\": \"21\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.3+galaxy4", - "type": "tool", - "uuid": "09524a39-45c1-4093-bc6b-ccdbbbc91e79", - "workflow_outputs": [ - { - "label": null, - "output_name": "read_db", - "uuid": "fdd64d8f-7be3-4664-886f-e168243d8465" - } - ] - }, - "6": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", - "errors": null, - "id": 6, - "input_connections": { - "input_list": { - "id": 4, - "output_name": "out1" - } - }, - "inputs": [], - "label": null, - "name": "Collapse Collection", - "outputs": [ - { - "name": "output", - "type": "input" - } - ], - "position": { - "bottom": 2374.815879128196, - "height": 44.20452880859375, - "left": 2223.5240589488635, - "right": 2289.5240589488635, - "top": 2330.611350319602, - "width": 66, - "x": 2223.5240589488635, - "y": 2330.611350319602 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/nml/collapse_collections/collapse_dataset/5.1.0", - "tool_shed_repository": { - "changeset_revision": "90981f86000f", - "name": "collapse_collections", - "owner": "nml", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"fastqsanger.gz\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"filename\": {\"add_name\": \"false\", \"__current_case__\": 1}, \"input_list\": {\"__class__\": \"ConnectedValue\"}, \"one_header\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.1.0", - "type": "tool", - "uuid": "a7dcf565-464e-4ff8-a3ee-d1abe6a34134", - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "7773735c-7a9e-4e73-a520-3b0094378110" - } - ] - }, - "7": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy4", - "errors": null, - "id": 7, - "input_connections": { - "operation_type|input_meryldb_02": { - "id": 5, - "output_name": "read_db" - } - }, - "inputs": [], - "label": null, - "name": "Meryl", - "outputs": [ - { - "name": "read_db", - "type": "meryldb" - } - ], - "position": { - "bottom": 1333.0712825890744, - "height": 37.475616455078125, - "left": -646.5852679628314, - "right": -580.5852679628314, - "top": 1295.5956661339962, - "width": 66, - "x": -646.5852679628314, - "y": 1295.5956661339962 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy4", - "tool_shed_repository": { - "changeset_revision": "eadfd71dde37", - "name": "meryl", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"operation_type\": {\"command_type\": \"groups-kmers\", \"__current_case__\": 3, \"groups_operations\": \"union-sum\", \"input_meryldb_02\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.3+galaxy4", - "type": "tool", - "uuid": "e10610dd-4ca0-4490-9d49-0484701d711e", - "workflow_outputs": [ - { - "label": null, - "output_name": "read_db", - "uuid": "4852beca-d492-486d-a87b-962f69920ad6" - } - ] - }, - "8": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy4", - "errors": null, - "id": 8, - "input_connections": { - "operation_type|input_meryldb_02": { - "id": 7, - "output_name": "read_db" - } - }, - "inputs": [], - "label": null, - "name": "Meryl", - "outputs": [ - { - "name": "read_db_hist", - "type": "tabular" - } - ], - "position": { - "bottom": 2249.0869381066523, - "height": 37.47564697265625, - "left": -358.4758411754261, - "right": -292.4758411754261, - "top": 2211.611291133996, - "width": 66, - "x": -358.4758411754261, - "y": 2211.611291133996 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy4", - "tool_shed_repository": { - "changeset_revision": "eadfd71dde37", - "name": "meryl", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"operation_type\": {\"command_type\": \"histogram-kmers\", \"__current_case__\": 4, \"input_meryldb_02\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.3+galaxy4", - "type": "tool", - "uuid": "86a0c60e-6ed9-438d-955b-4a13d34fa69b", - "workflow_outputs": [ - { - "label": null, - "output_name": "read_db_hist", - "uuid": "e4798cd6-a847-492c-9efd-1f5d227bf1d8" - } - ] - }, - "9": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/genomescope/genomescope/2.0+galaxy1", - "errors": null, - "id": 9, - "input_connections": { - "input": { - "id": 8, - "output_name": "read_db_hist" - } - }, - "inputs": [], - "label": null, - "name": "GenomeScope", - "outputs": [ - { - "name": "linear_plot", - "type": "png" - }, - { - "name": "log_plot", - "type": "png" - }, - { - "name": "transformed_linear_plot", - "type": "png" - }, - { - "name": "transformed_log_plot", - "type": "png" - }, - { - "name": "summary", - "type": "txt" - }, - { - "name": "model_params", - "type": "tabular" - } - ], - "position": { - "bottom": 2347.791522401752, - "height": 148.1802978515625, - "left": -80.56964296283144, - "right": -14.569627704042375, - "top": 2199.6112245501895, - "width": 66.00001525878906, - "x": -80.56964296283144, - "y": 2199.6112245501895 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/genomescope/genomescope/2.0+galaxy1", - "tool_shed_repository": { - "changeset_revision": "3169a38c2656", - "name": "genomescope", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"advanced_options\": {\"topology\": null, \"initial_repetitiveness\": null, \"initial_heterozygosities\": \"\", \"transform_exp\": null, \"testing\": \"true\", \"true_params\": \"\", \"trace_flag\": \"false\", \"num_rounds\": null}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"kmer_length\": \"21\", \"lambda\": null, \"max_kmercov\": null, \"output_options\": {\"output_files\": [\"summary_output\"], \"no_unique_sequence\": \"false\"}, \"ploidy\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.0+galaxy1", - "type": "tool", - "uuid": "33b89b76-9661-4a04-bcd1-08845533e502", - "workflow_outputs": [ - { - "label": null, - "output_name": "transformed_log_plot", - "uuid": "99f43026-046e-49c9-8e57-4a6b13c5b7e3" - }, - { - "label": null, - "output_name": "transformed_linear_plot", - "uuid": "96f38618-c254-4cfa-b5c6-281237924d04" - }, - { - "label": null, - "output_name": "linear_plot", - "uuid": "190de9bf-15f9-4336-8172-a568bf7a8067" - }, - { - "label": null, - "output_name": "summary", - "uuid": "156d21bb-bdf4-446f-92c0-c899cacc3241" - }, - { - "label": null, - "output_name": "log_plot", - "uuid": "ab338100-cce9-4bf0-a32a-eb3a2f12c1cf" - }, - { - "label": null, - "output_name": "model_params", - "uuid": "e4eee33e-3be0-4b6d-83cb-4e2e83be8b13" - } - ] - }, - "10": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6", - "errors": null, - "id": 10, - "input_connections": { - "input": { - "id": 9, - "output_name": "model_params" - } - }, - "inputs": [], - "label": null, - "name": "Compute", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "bottom": 2303.3423498905067, - "height": 30.74676513671875, - "left": 207.52415512547347, - "right": 273.5241551254735, - "top": 2272.595584753788, - "width": 66, - "x": 207.52415512547347, - "y": 2272.595584753788 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6", - "tool_shed_repository": { - "changeset_revision": "02026300aa45", - "name": "column_maker", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"tabular\", \"avoid_scientific_notation\": \"false\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"cond\": \"1.5*c3\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.6", - "type": "tool", - "uuid": "6d662c83-b746-4994-83a3-febfcc350851", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_file1", - "uuid": "a9625c03-b443-41de-bd2f-c3ae4f6d090c" - } - ] - }, - "11": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", - "errors": null, - "id": 11, - "input_connections": { - "infile": { - "id": 9, - "output_name": "summary" - } - }, - "inputs": [], - "label": null, - "name": "Replace", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "bottom": 2485.3580026337595, - "height": 30.7467041015625, - "left": 207.52415512547347, - "right": 273.5241551254735, - "top": 2454.611298532197, - "width": 66, - "x": 207.52415512547347, - "y": 2454.611298532197 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"txt\", \"caseinsensitive\": \"false\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"find_pattern\": \"bp\", \"global\": \"true\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": \"false\", \"replace_pattern\": \"\", \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}, \"skip_first_line\": \"false\", \"wholewords\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.3", - "type": "tool", - "uuid": "fb143b52-3c57-4ee9-813a-85d1b5c89f57", - "workflow_outputs": [ - { - "label": null, - "output_name": "outfile", - "uuid": "37e10dce-1aa5-46c6-9d31-1a64db93360d" - } - ] - }, - "12": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6", - "errors": null, - "id": 12, - "input_connections": { - "input": { - "id": 10, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Compute", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "bottom": 2303.3423498905067, - "height": 30.74676513671875, - "left": 495.50855232007575, - "right": 561.5085370612867, - "top": 2272.595584753788, - "width": 65.99998474121094, - "x": 495.50855232007575, - "y": 2272.595584753788 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/1.6", - "tool_shed_repository": { - "changeset_revision": "02026300aa45", - "name": "column_maker", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"tabular\", \"avoid_scientific_notation\": \"false\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"cond\": \"3*c7\", \"header_lines_conditional\": {\"header_lines_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"round\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.6", - "type": "tool", - "uuid": "189d73fa-00cf-4c7a-bd50-eb28bfedbd42", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_file1", - "uuid": "b3e8887f-e032-42a6-8c38-dc83dd3d73c9" - } - ] - }, - "13": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", - "errors": null, - "id": 13, - "input_connections": { - "infile": { - "id": 11, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "Replace", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "bottom": 2485.3580026337595, - "height": 30.7467041015625, - "left": 495.50855232007575, - "right": 561.5085370612867, - "top": 2454.611298532197, - "width": 65.99998474121094, - "x": 495.50855232007575, - "y": 2454.611298532197 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"txt\", \"caseinsensitive\": \"false\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"find_pattern\": \",\", \"global\": \"true\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": \"false\", \"replace_pattern\": \"\", \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}, \"skip_first_line\": \"false\", \"wholewords\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.3", - "type": "tool", - "uuid": "ca15ccc7-2122-4972-b510-e0f0cd46d6a3", - "workflow_outputs": [ - { - "label": null, - "output_name": "outfile", - "uuid": "9863a2fa-1b28-4703-93f8-2d552b544334" - } - ] - }, - "14": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0", - "errors": null, - "id": 14, - "input_connections": { - "input": { - "id": 12, - "output_name": "out_file1" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Advanced Cut", - "name": "input" - } - ], - "label": null, - "name": "Advanced Cut", - "outputs": [ - { - "name": "output", - "type": "tabular" - } - ], - "position": { - "bottom": 2118.0712761156487, - "height": 37.47564697265625, - "left": 773.5085227272726, - "right": 839.5085227272726, - "top": 2080.5956291429925, - "width": 66, - "x": 773.5085227272726, - "y": 2080.5956291429925 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"complement\": \"\", \"cut_type_options\": {\"cut_element\": \"-f\", \"__current_case__\": 0, \"list\": \"7\\n\"}, \"delimiter\": \"\", \"input\": {\"__class__\": \"RuntimeValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.0", - "type": "tool", - "uuid": "37255296-b78f-488b-99be-abe6bc9afb50", - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "08cd3c5d-525d-42a9-97b7-e0867ff7cf00" - } - ] - }, - "15": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0", - "errors": null, - "id": 15, - "input_connections": { - "input": { - "id": 12, - "output_name": "out_file1" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Advanced Cut", - "name": "input" - } - ], - "label": null, - "name": "Advanced Cut", - "outputs": [ - { - "name": "output", - "type": "tabular" - } - ], - "position": { - "bottom": 2300.0869288589015, - "height": 37.4755859375, - "left": 773.5085227272726, - "right": 839.5085227272726, - "top": 2262.6113429214015, - "width": 66, - "x": 773.5085227272726, - "y": 2262.6113429214015 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"complement\": \"\", \"cut_type_options\": {\"cut_element\": \"-f\", \"__current_case__\": 0, \"list\": \"8\\n\"}, \"delimiter\": \"\", \"input\": {\"__class__\": \"RuntimeValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.0", - "type": "tool", - "uuid": "a065939e-7d41-45fa-bda8-2ae34350ae84", - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "40044ea0-8d91-41e4-8f64-e50e73f07591" - } - ] - }, - "16": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", - "errors": null, - "id": 16, - "input_connections": { - "infile": { - "id": 13, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "Search in textfiles", - "outputs": [ - { - "name": "output", - "type": "input" - } - ], - "position": { - "bottom": 2482.0869214607005, - "height": 37.4755859375, - "left": 773.5085227272726, - "right": 839.5085227272726, - "top": 2444.6113355232005, - "width": 66, - "x": 773.5085227272726, - "y": 2444.6113355232005 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"txt\", \"case_sensitive\": \"-i\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-G\", \"url_paste\": \"Haploid\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.1", - "type": "tool", - "uuid": "fbdba375-7b98-4ba7-a039-b8f2dd3f53e5", - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "22d3d363-fc6b-4a30-be17-c9646f2ba411" - } - ] - }, - "17": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 17, - "input_connections": { - "input1": { - "id": 14, - "output_name": "output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Parse parameter value", - "name": "input1" - } - ], - "label": "Transition parameter", - "name": "Parse parameter value", - "outputs": [ - { - "name": "integer_param", - "type": "expression.json" - } - ], - "position": { - "bottom": 2111.5291137695312, - "height": 50.93341064453125, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 2060.595703125, - "width": 66, - "x": 1081.5241033380682, - "y": 2060.595703125 - }, - "post_job_actions": { - "HideDatasetActioninteger_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "integer_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"RuntimeValue\"}, \"param_type\": \"integer\", \"remove_newlines\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.0", - "type": "tool", - "uuid": "e525f6e5-6adc-4fdb-bb36-ab67f099d397", - "workflow_outputs": [] - }, - "18": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 18, - "input_connections": { - "input1": { - "id": 15, - "output_name": "output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Parse parameter value", - "name": "input1" - } - ], - "label": "Upper bound", - "name": "Parse parameter value", - "outputs": [ - { - "name": "integer_param", - "type": "expression.json" - } - ], - "position": { - "bottom": 2296.81572376598, - "height": 44.20452880859375, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 2252.611194957386, - "width": 66, - "x": 1081.5241033380682, - "y": 2252.611194957386 - }, - "post_job_actions": { - "HideDatasetActioninteger_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "integer_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"RuntimeValue\"}, \"param_type\": \"integer\", \"remove_newlines\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.0", - "type": "tool", - "uuid": "538f917a-0632-40ec-a416-0a9e77c44993", - "workflow_outputs": [] - }, - "19": { - "annotation": "", - "content_id": "Convert characters1", - "errors": null, - "id": 19, - "input_connections": { - "input": { - "id": 16, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Convert", - "outputs": [ - { - "name": "out_file1", - "type": "tabular" - } - ], - "position": { - "bottom": 2485.3580026337595, - "height": 30.7467041015625, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 2454.611298532197, - "width": 66, - "x": 1081.5241033380682, - "y": 2454.611298532197 - }, - "post_job_actions": {}, - "tool_id": "Convert characters1", - "tool_state": "{\"__input_ext\": \"txt\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"condense\": \"true\", \"convert_from\": \"s\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"strip\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", - "type": "tool", - "uuid": "fd6f966f-feff-4e88-b650-c9f693e511bc", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_file1", - "uuid": "050ecbee-75e4-49d5-b4e5-fb942239e85b" - } - ] - }, - "20": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy2", - "errors": null, - "id": 20, - "input_connections": { - "hic_partition|h1": { - "id": 0, - "output_name": "output" - }, - "hic_partition|h2": { - "id": 1, - "output_name": "output" - }, - "mode|reads": { - "id": 4, - "output_name": "out1" - }, - "purge_options|purge_max": { - "id": 18, - "output_name": "integer_param" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Hifiasm", - "name": "hic_partition" - }, - { - "description": "runtime parameter for tool Hifiasm", - "name": "hic_partition" - }, - { - "description": "runtime parameter for tool Hifiasm", - "name": "mode" - } - ], - "label": null, - "name": "Hifiasm", - "outputs": [ - { - "name": "hic_pcontig_graph", - "type": "gfa1" - }, - { - "name": "hic_acontig_graph", - "type": "gfa1" - }, - { - "name": "hic_balanced_contig_hap1_graph", - "type": "gfa1" - }, - { - "name": "hic_balanced_contig_hap2_graph", - "type": "gfa1" - } - ], - "position": { - "bottom": 1146.3627014160156, - "height": 144.75137329101562, - "left": 495.50855232007575, - "right": 561.5085370612867, - "top": 1001.611328125, - "width": 65.99998474121094, - "x": 495.50855232007575, - "y": 1001.611328125 - }, - "post_job_actions": { - "HideDatasetActionhic_acontig_graph": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "hic_acontig_graph" - }, - "HideDatasetActionhic_pcontig_graph": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "hic_pcontig_graph" - } - }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy2", - "tool_shed_repository": { - "changeset_revision": "5bec28269d95", - "name": "hifiasm", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"advanced_options\": {\"advanced_selector\": \"blank\", \"__current_case__\": 0}, \"assembly_options\": {\"assembly_selector\": \"blank\", \"__current_case__\": 0}, \"filter_bits\": \"37\", \"hic_partition\": {\"hic_partition_selector\": \"set\", \"__current_case__\": 1, \"h1\": {\"__class__\": \"RuntimeValue\"}, \"h2\": {\"__class__\": \"RuntimeValue\"}, \"seed\": null, \"n_weight\": null, \"n_perturb\": null, \"f_perturb\": null, \"l_msjoin\": \"500000\"}, \"log_out\": \"false\", \"mode\": {\"mode_selector\": \"standard\", \"__current_case__\": 0, \"reads\": {\"__class__\": \"RuntimeValue\"}}, \"purge_options\": {\"purge_selector\": \"set\", \"__current_case__\": 1, \"purge_level\": \"0\", \"similarity_threshold\": \"0.75\", \"minimum_overlap\": \"1\", \"purge_max\": {\"__class__\": \"ConnectedValue\"}, \"n_hap\": null}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.16.1+galaxy2", - "type": "tool", - "uuid": "981d04da-27c4-471b-bbff-915625462bbe", - "workflow_outputs": [ - { - "label": null, - "output_name": "hic_balanced_contig_hap2_graph", - "uuid": "a93d61d5-bdfe-48fc-a027-7a2ddf306f3c" - }, - { - "label": null, - "output_name": "hic_balanced_contig_hap1_graph", - "uuid": "f0c2c6d9-002b-425f-b506-e5087ab75a18" - } - ] - }, - "21": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0", - "errors": null, - "id": 21, - "input_connections": { - "input": { - "id": 19, - "output_name": "out_file1" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Advanced Cut", - "name": "input" - } - ], - "label": null, - "name": "Advanced Cut", - "outputs": [ - { - "name": "output", - "type": "tabular" - } - ], - "position": { - "bottom": 2482.0869214607005, - "height": 37.4755859375, - "left": 1359.5085375236742, - "right": 1425.5085375236742, - "top": 2444.6113355232005, - "width": 66, - "x": 1359.5085375236742, - "y": 2444.6113355232005 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/1.1.0", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"complement\": \"\", \"cut_type_options\": {\"cut_element\": \"-f\", \"__current_case__\": 0, \"list\": \"5\\n\"}, \"delimiter\": \"\", \"input\": {\"__class__\": \"RuntimeValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.0", - "type": "tool", - "uuid": "c6acbefe-f7ab-426b-84d7-7adf3ea71970", - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "936cb6dc-3b06-4edb-93af-f46891c97777" - } - ] - }, - "22": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/gfa_to_fa/gfa_to_fa/0.1.2", - "errors": null, - "id": 22, - "input_connections": { - "in_gfa": { - "id": 20, - "output_name": "hic_balanced_contig_hap2_graph" - } - }, - "inputs": [], - "label": null, - "name": "GFA to FASTA", - "outputs": [ - { - "name": "out_fa", - "type": "fasta" - } - ], - "position": { - "bottom": 1075.8002097389915, - "height": 44.20452880859375, - "left": 773.5085227272726, - "right": 839.5085227272726, - "top": 1031.5956809303977, - "width": 66, - "x": 773.5085227272726, - "y": 1031.5956809303977 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/gfa_to_fa/gfa_to_fa/0.1.2", - "tool_shed_repository": { - "changeset_revision": "e33c82b63727", - "name": "gfa_to_fa", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"in_gfa\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.2", - "type": "tool", - "uuid": "43474147-7c56-4609-8ced-529b6972623e", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_fa", - "uuid": "07a9bbaf-73a2-4f6e-b4b6-bcf790f9961c" - } - ] - }, - "23": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/gfa_to_fa/gfa_to_fa/0.1.2", - "errors": null, - "id": 23, - "input_connections": { - "in_gfa": { - "id": 20, - "output_name": "hic_balanced_contig_hap1_graph" - } - }, - "inputs": [], - "label": null, - "name": "GFA to FASTA", - "outputs": [ - { - "name": "out_fa", - "type": "fasta" - } - ], - "position": { - "bottom": 1319.8158051461885, - "height": 44.20452880859375, - "left": 773.5085227272726, - "right": 839.5085227272726, - "top": 1275.6112763375947, - "width": 66, - "x": 773.5085227272726, - "y": 1275.6112763375947 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/gfa_to_fa/gfa_to_fa/0.1.2", - "tool_shed_repository": { - "changeset_revision": "e33c82b63727", - "name": "gfa_to_fa", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"in_gfa\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.2", - "type": "tool", - "uuid": "5910ad13-7012-4c38-a5a8-5709a3c15994", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_fa", - "uuid": "b0550d57-f348-4057-ab6c-ffce7ecd2437" - } - ] - }, - "24": { - "annotation": "", - "content_id": "param_value_from_file", - "errors": null, - "id": 24, - "input_connections": { - "input1": { - "id": 21, - "output_name": "output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Parse parameter value", - "name": "input1" - } - ], - "label": "Estimated genome size", - "name": "Parse parameter value", - "outputs": [ - { - "name": "integer_param", - "type": "expression.json" - } - ], - "position": { - "bottom": 2475.544696229877, - "height": 50.9334716796875, - "left": 1637.5085079308712, - "right": 1703.5085079308712, - "top": 2424.6112245501895, - "width": 66, - "x": 1637.5085079308712, - "y": 2424.6112245501895 - }, - "post_job_actions": { - "HideDatasetActioninteger_param": { - "action_arguments": {}, - "action_type": "HideDatasetAction", - "output_name": "integer_param" - } - }, - "tool_id": "param_value_from_file", - "tool_state": "{\"input1\": {\"__class__\": \"RuntimeValue\"}, \"param_type\": \"integer\", \"remove_newlines\": \"true\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.0", - "type": "tool", - "uuid": "bb1d6a46-6032-4dd6-8a3d-69ede06047ce", - "workflow_outputs": [] - }, - "25": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "errors": null, - "id": 25, - "input_connections": { - "input": { - "id": 22, - "output_name": "out_fa" - } - }, - "inputs": [], - "label": null, - "name": "Busco", - "outputs": [ - { - "name": "busco_sum", - "type": "txt" - }, - { - "name": "busco_table", - "type": "tabular" - } - ], - "position": { - "bottom": 1186.2869086988044, - "height": 67.69125366210938, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 1118.595655036695, - "width": 66, - "x": 1081.5241033380682, - "y": 1118.595655036695 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "46ae58b1d792", - "name": "busco", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"saccharomycetes_odb10\"}, \"outputs\": [\"short_summary\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.2.2+galaxy2", - "type": "tool", - "uuid": "bbadf584-b321-4280-a5d4-be9c327c5087", - "workflow_outputs": [ - { - "label": null, - "output_name": "busco_sum", - "uuid": "53701c97-fd2a-4d18-8ad1-502a21bc50d8" - }, - { - "label": null, - "output_name": "busco_table", - "uuid": "a3dd7f65-4ae0-4388-8d09-bf13f43f18ac" - } - ] - }, - "26": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy1", - "errors": null, - "id": 26, - "input_connections": { - "mode|assembly_options|assembly_01": { - "id": 23, - "output_name": "out_fa" - }, - "mode|assembly_options|assembly_02": { - "id": 22, - "output_name": "out_fa" - }, - "mode|meryldb_F1": { - "id": 7, - "output_name": "read_db" - } - }, - "inputs": [], - "label": null, - "name": "Merqury", - "outputs": [ - { - "name": "qv_files", - "type": "input" - }, - { - "name": "png_files", - "type": "input" - }, - { - "name": "stats_files", - "type": "input" - } - ], - "position": { - "bottom": 872.6447531960226, - "height": 91.049072265625, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 781.5956809303976, - "width": 66, - "x": 1081.5241033380682, - "y": 781.5956809303976 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy1", - "tool_shed_repository": { - "changeset_revision": "39edec572bae", - "name": "merqury", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"label\": \"output_merqury\", \"mode\": {\"options\": \"default\", \"__current_case__\": 0, \"meryldb_F1\": {\"__class__\": \"ConnectedValue\"}, \"assembly_options\": {\"number_assemblies\": \"two\", \"__current_case__\": 1, \"assembly_01\": {\"__class__\": \"ConnectedValue\"}, \"assembly_02\": {\"__class__\": \"ConnectedValue\"}}}, \"output_selector\": [\"qv\", \"plots\", \"stats\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.3+galaxy1", - "type": "tool", - "uuid": "21e13849-7836-42a5-b57b-d1d55dab9b19", - "workflow_outputs": [ - { - "label": null, - "output_name": "qv_files", - "uuid": "34470957-c558-4e64-8af0-f0bf89d931d6" - }, - { - "label": null, - "output_name": "stats_files", - "uuid": "45a7ce2f-afc7-4100-98c5-fe6d4013a464" - }, - { - "label": null, - "output_name": "png_files", - "uuid": "2be0f6f9-b852-4e9d-9428-12d085b8f1e6" - } - ] - }, - "27": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "errors": null, - "id": 27, - "input_connections": { - "input": { - "id": 23, - "output_name": "out_fa" - } - }, - "inputs": [], - "label": null, - "name": "Busco", - "outputs": [ - { - "name": "busco_sum", - "type": "txt" - }, - { - "name": "busco_table", - "type": "tabular" - } - ], - "position": { - "bottom": 1430.2868448893228, - "height": 67.69122314453125, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 1362.5956217447915, - "width": 66, - "x": 1081.5241033380682, - "y": 1362.5956217447915 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "46ae58b1d792", - "name": "busco", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"saccharomycetes_odb10\"}, \"outputs\": [\"short_summary\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.2.2+galaxy2", - "type": "tool", - "uuid": "97853834-9bec-435c-8d27-5b2272079f69", - "workflow_outputs": [ - { - "label": null, - "output_name": "busco_sum", - "uuid": "56773a24-69f9-475f-aaf5-40cf075448a6" - }, - { - "label": null, - "output_name": "busco_table", - "uuid": "7bf0073a-ba33-410a-927d-4b2da4df8c8a" - } - ] - }, - "28": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 28, - "input_connections": { - "function_select|input": { - "id": 23, - "output_name": "out_fa" - } - }, - "inputs": [], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "split_fasta", - "type": "fasta" - } - ], - "position": { - "bottom": 1656.5291008226798, - "height": 50.9334716796875, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 1605.5956291429923, - "width": 66, - "x": 1081.5241033380682, - "y": 1605.5956291429923 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"function_select\": {\"functions\": \"split_fa\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "36f0a1f5-e662-408b-a8a5-40a4f2cca2de", - "workflow_outputs": [ - { - "label": null, - "output_name": "split_fasta", - "uuid": "698b38fa-be8f-4510-86a8-b5dba07e9544" - } - ] - }, - "29": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "errors": null, - "id": 29, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 4, - "output_name": "out1" - }, - "reference_source|ref_file": { - "id": 23, - "output_name": "out_fa" - } - }, - "inputs": [], - "label": null, - "name": "Map with minimap2", - "outputs": [ - { - "name": "alignment_output", - "type": "bam" - } - ], - "position": { - "bottom": 1872.0157507694128, - "height": 74.420166015625, - "left": 1081.5241033380682, - "right": 1147.5241033380682, - "top": 1797.5955847537878, - "width": 66, - "x": 1081.5241033380682, - "y": 1797.5955847537878 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "tool_shed_repository": { - "changeset_revision": "11a0d50a54e6", - "name": "minimap2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": \"true\"}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"asm5\"}, \"fastq_input1|__identifier__\": \"SRR13577846_1\", \"indexing_options\": {\"H\": \"false\", \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": \"false\", \"L\": \"false\", \"K\": null, \"cs\": null, \"c\": \"false\", \"eqx\": \"false\", \"Y\": \"false\"}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": \"false\", \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.24+galaxy0", - "type": "tool", - "uuid": "b0ef8e59-2631-45c7-acf0-f2042b8d7b69", - "workflow_outputs": [ - { - "label": null, - "output_name": "alignment_output", - "uuid": "b196a114-96c6-40c8-8a42-9d303fc842c7" - } - ] - }, - "30": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "errors": null, - "id": 30, - "input_connections": { - "assembly|ref|est_ref_size": { - "id": 24, - "output_name": "integer_param" - }, - "in|inputs_0|input": { - "id": 23, - "output_name": "out_fa" - }, - "in|inputs_1|input": { - "id": 22, - "output_name": "out_fa" - }, - "reads|input_1": { - "id": 4, - "output_name": "out1" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Quast", - "name": "reads" - } - ], - "label": null, - "name": "Quast", - "outputs": [ - { - "name": "report_html", - "type": "html" - } - ], - "position": { - "bottom": 991.7869040749289, - "height": 101.20684814453125, - "left": 1925.4616477272727, - "right": 1991.4616477272727, - "top": 890.5800559303976, - "width": 66, - "x": 1925.4616477272727, - "y": 890.5800559303976 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "tool_shed_repository": { - "changeset_revision": "875d0f36d66f", - "name": "quast", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"advanced\": {\"contig_thresholds\": \"0,1000\", \"strict_NA\": \"false\", \"extensive_mis_size\": \"1000\", \"scaffold_gap_max_size\": \"1000\", \"unaligned_part_size\": \"500\", \"skip_unaligned_mis_contigs\": \"true\", \"fragmented_max_indent\": null}, \"alignments\": {\"use_all_alignments\": \"false\", \"min_alignment\": \"65\", \"min_identity\": \"95.0\", \"ambiguity_usage\": \"one\", \"ambiguity_score\": \"0.99\", \"fragmented\": \"false\", \"upper_bound_assembly\": \"false\", \"upper_bound_min_con\": null}, \"assembly\": {\"type\": \"genome\", \"__current_case__\": 0, \"ref\": {\"use_ref\": \"false\", \"__current_case__\": 1, \"est_ref_size\": {\"__class__\": \"ConnectedValue\"}}, \"orga_type\": \"--eukaryote\"}, \"genes\": {\"gene_finding\": {\"tool\": \"none\", \"__current_case__\": 0}, \"rna_finding\": \"false\", \"conserved_genes_finding\": \"false\"}, \"in\": {\"custom\": \"true\", \"__current_case__\": 0, \"inputs\": [{\"__index__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}, \"labels\": \"Primary assebly\"}, {\"__index__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}, \"labels\": \"Alternate assembly\"}]}, \"large\": \"false\", \"min_contig\": \"500\", \"output_files\": [\"html\"], \"reads\": {\"reads_option\": \"pacbio\", \"__current_case__\": 5, \"input_1\": {\"__class__\": \"RuntimeValue\"}}, \"split_scaffolds\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.0.2+galaxy4", - "type": "tool", - "uuid": "c1d5c438-6d68-437d-90c1-aeeb46304be1", - "workflow_outputs": [ - { - "label": null, - "output_name": "report_html", - "uuid": "a0988654-d08b-4e08-9803-ed9133f35a69" - } - ] - }, - "31": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "errors": null, - "id": 31, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 28, - "output_name": "split_fasta" - }, - "reference_source|ref_file": { - "id": 28, - "output_name": "split_fasta" - } - }, - "inputs": [], - "label": null, - "name": "Map with minimap2", - "outputs": [ - { - "name": "alignment_output", - "type": "bam" - } - ], - "position": { - "bottom": 1685.015869140625, - "height": 74.420166015625, - "left": 1359.5085375236742, - "right": 1425.5085375236742, - "top": 1610.595703125, - "width": 66, - "x": 1359.5085375236742, - "y": 1610.595703125 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "tool_shed_repository": { - "changeset_revision": "11a0d50a54e6", - "name": "minimap2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": \"true\"}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"self-homology\"}, \"indexing_options\": {\"H\": \"false\", \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": \"false\", \"L\": \"false\", \"K\": null, \"cs\": null, \"c\": \"false\", \"eqx\": \"false\", \"Y\": \"false\"}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": \"false\", \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.24+galaxy0", - "type": "tool", - "uuid": "c9b90a4d-e3a6-4b72-84ef-9d0374b896e4", - "workflow_outputs": [ - { - "label": null, - "output_name": "alignment_output", - "uuid": "9b6ec151-11dc-4477-8740-fc70f5ca3d86" - } - ] - }, - "32": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 32, - "input_connections": { - "function_select|input": { - "id": 29, - "output_name": "alignment_output" - }, - "function_select|section_calcuts|transition": { - "id": 17, - "output_name": "integer_param" - }, - "function_select|section_calcuts|upper_depth": { - "id": 18, - "output_name": "integer_param" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - } - ], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "pbcstat_cov", - "type": "tabular" - }, - { - "name": "hist", - "type": "png" - }, - { - "name": "calcuts_cutoff", - "type": "tabular" - } - ], - "position": { - "bottom": 2113.289277047822, - "height": 124.693603515625, - "left": 1359.5085375236742, - "right": 1425.5085375236742, - "top": 1988.5956735321968, - "width": 66, - "x": 1359.5085375236742, - "y": 1988.5956735321968 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"function_select\": {\"functions\": \"pbcstat\", \"__current_case__\": 2, \"input\": {\"__class__\": \"RuntimeValue\"}, \"pbcstat_options\": {\"max_cov\": \"500\", \"min_map_ratio\": \"0.0\", \"min_map_qual\": null, \"flank\": \"0\", \"primary_alignments\": \"true\"}, \"section_calcuts\": {\"min_depth\": \"0.1\", \"low_depth\": null, \"transition\": {\"__class__\": \"ConnectedValue\"}, \"upper_depth\": {\"__class__\": \"ConnectedValue\"}, \"ploidy\": \"-d 0\"}, \"section_hist\": {\"ymin\": null, \"ymax\": null, \"xmin\": null, \"xmax\": null, \"title\": \"Read depth histogram plot\"}, \"output_options\": [\"pbcstat_coverage\", \"histogram\", \"calcuts_cutoff\"]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "2b7791ec-5f27-4b8f-ad94-1770c1895c70", - "workflow_outputs": [ - { - "label": null, - "output_name": "pbcstat_cov", - "uuid": "e99b7258-5f0d-4335-89c9-32d1b19f580d" - }, - { - "label": null, - "output_name": "hist", - "uuid": "8fb79644-8f37-4fac-aa18-80f7e4b8b4e0" - }, - { - "label": null, - "output_name": "calcuts_cutoff", - "uuid": "fd0f7672-419c-4ed5-87bd-9f2aed33e0d3" - } - ] - }, - "33": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 33, - "input_connections": { - "function_select|coverage": { - "id": 32, - "output_name": "pbcstat_cov" - }, - "function_select|cutoffs": { - "id": 32, - "output_name": "calcuts_cutoff" - }, - "function_select|input": { - "id": 31, - "output_name": "alignment_output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - }, - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - }, - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - } - ], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "purge_dups_bed", - "type": "bed" - } - ], - "position": { - "bottom": 2074.586921460701, - "height": 70.9912109375, - "left": 1637.5085079308712, - "right": 1703.5085079308712, - "top": 2003.5957105232008, - "width": 66, - "x": 1637.5085079308712, - "y": 2003.5957105232008 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"function_select\": {\"functions\": \"purge_dups\", \"__current_case__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}, \"coverage\": {\"__class__\": \"RuntimeValue\"}, \"cutoffs\": {\"__class__\": \"RuntimeValue\"}, \"min_bad\": \"0.8\", \"min_align\": \"70\", \"min_match\": \"200\", \"min_chain\": \"500\", \"max_gap\": \"20000\", \"double_chain\": {\"chaining_rounds\": \"one\", \"__current_case__\": 1}, \"min_chain_score\": \"10000\", \"max_extend\": \"15000\", \"log_file\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "9aca1622-3a22-4602-8d2d-8d36becd63f1", - "workflow_outputs": [ - { - "label": null, - "output_name": "purge_dups_bed", - "uuid": "6fe2bec0-96fd-4fd8-9c2c-354e414c4e01" - } - ] - }, - "34": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 34, - "input_connections": { - "function_select|bed_input": { - "id": 33, - "output_name": "purge_dups_bed" - }, - "function_select|fasta_input": { - "id": 23, - "output_name": "out_fa" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - }, - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - } - ], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "get_seqs_hap", - "type": "fasta" - }, - { - "name": "get_seqs_purged", - "type": "fasta" - } - ], - "position": { - "bottom": 1399.0602971857243, - "height": 84.44903564453125, - "left": 1925.4616477272727, - "right": 1991.4616477272727, - "top": 1314.611261541193, - "width": 66, - "x": 1925.4616477272727, - "y": 1314.611261541193 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"function_select\": {\"functions\": \"get_seqs\", \"__current_case__\": 5, \"fasta_input\": {\"__class__\": \"RuntimeValue\"}, \"bed_input\": {\"__class__\": \"RuntimeValue\"}, \"advanced_options\": {\"coverage\": \"false\", \"haplotigs\": \"false\", \"length\": \"10000\", \"min_ratio\": \"0.05\", \"end_trim\": \"true\", \"split\": \"false\", \"min_gap\": \"10000\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "d69ed63b-9065-4c55-94b8-88c0b88e6976", - "workflow_outputs": [ - { - "label": null, - "output_name": "get_seqs_purged", - "uuid": "37bd9afc-80e8-4855-ab52-8c013cf71b18" - }, - { - "label": null, - "output_name": "get_seqs_hap", - "uuid": "0855301e-baa3-4acc-b7c4-d4ed1a92cb81" - } - ] - }, - "35": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/bionano_scaffold/bionano_scaffold/3.7.0+galaxy0", - "errors": null, - "id": 35, - "input_connections": { - "bionano_cmap": { - "id": 3, - "output_name": "output" - }, - "ngs_fasta": { - "id": 34, - "output_name": "get_seqs_purged" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Bionano Hybrid Scaffold", - "name": "bionano_cmap" - }, - { - "description": "runtime parameter for tool Bionano Hybrid Scaffold", - "name": "conflict_resolution" - }, - { - "description": "runtime parameter for tool Bionano Hybrid Scaffold", - "name": "ngs_fasta" - } - ], - "label": null, - "name": "Bionano Hybrid Scaffold", - "outputs": [ - { - "name": "ngs_contigs_scaffold_trimmed", - "type": "fasta" - }, - { - "name": "ngs_contigs_not_scaffolded_trimmed", - "type": "fasta" - }, - { - "name": "report", - "type": "txt" - }, - { - "name": "conflicts", - "type": "txt" - }, - { - "name": "ngs_contigs_scaffold_agp", - "type": "agp" - } - ], - "position": { - "bottom": 948.9603437943891, - "height": 178.39593505859375, - "left": 2223.5240589488635, - "right": 2289.5240589488635, - "top": 770.5644087357954, - "width": 66, - "x": 2223.5240589488635, - "y": 770.5644087357954 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/bionano_scaffold/bionano_scaffold/3.7.0+galaxy0", - "tool_shed_repository": { - "changeset_revision": "5258e18bbe23", - "name": "bionano_scaffold", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bionano_cmap\": {\"__class__\": \"RuntimeValue\"}, \"configuration_options\": {\"configuration\": \"vgp\", \"__current_case__\": 0, \"enzyme\": \"CTTAAG\"}, \"conflict_filter_genome\": \"2\", \"conflict_filter_sequence\": \"2\", \"conflict_resolution\": {\"__class__\": \"RuntimeValue\"}, \"ngs_fasta\": {\"__class__\": \"RuntimeValue\"}, \"trim_cut_sites\": \"true\", \"zip_file\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "3.7.0+galaxy0", - "type": "tool", - "uuid": "8afd7b0b-f414-4fb6-8026-ba3bdd333f2e", - "workflow_outputs": [ - { - "label": null, - "output_name": "ngs_contigs_not_scaffolded_trimmed", - "uuid": "0ae77c95-1392-4c91-bfb7-c59627dd06de" - }, - { - "label": null, - "output_name": "conflicts", - "uuid": "c3d98160-5c67-4755-9c5e-1d08e3a98808" - }, - { - "label": null, - "output_name": "ngs_contigs_scaffold_trimmed", - "uuid": "3d080b0c-b71b-4f75-954d-bb2022e2efa7" - }, - { - "label": null, - "output_name": "report", - "uuid": "b5bdd44d-fbcd-4643-9cd8-c655371a4bea" - }, - { - "label": null, - "output_name": "ngs_contigs_scaffold_agp", - "uuid": "2c2081c3-6c88-4da4-b1ac-28ee2e9ebe7a" - } - ] - }, - "36": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "errors": null, - "id": 36, - "input_connections": { - "input": { - "id": 34, - "output_name": "get_seqs_purged" - } - }, - "inputs": [], - "label": null, - "name": "Busco", - "outputs": [ - { - "name": "busco_sum", - "type": "txt" - }, - { - "name": "busco_table", - "type": "tabular" - } - ], - "position": { - "bottom": 1417.3025087298768, - "height": 67.6912841796875, - "left": 2223.5240589488635, - "right": 2289.5240589488635, - "top": 1349.6112245501893, - "width": 66, - "x": 2223.5240589488635, - "y": 1349.6112245501893 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "46ae58b1d792", - "name": "busco", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"saccharomycetes_odb10\"}, \"outputs\": [\"short_summary\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.2.2+galaxy2", - "type": "tool", - "uuid": "5a25e3ee-3b1a-4e53-b065-71430d5b1ac6", - "workflow_outputs": [ - { - "label": null, - "output_name": "busco_sum", - "uuid": "52fa2e25-c5e9-4a81-9f17-56a1cd1528a6" - }, - { - "label": null, - "output_name": "busco_table", - "uuid": "13af5346-e82f-4c6b-b8e1-4a1a38555545" - } - ] - }, - "37": { - "annotation": "", - "content_id": "cat1", - "errors": null, - "id": 37, - "input_connections": { - "input1": { - "id": 34, - "output_name": "get_seqs_hap" - }, - "queries_0|input2": { - "id": 22, - "output_name": "out_fa" - } - }, - "inputs": [], - "label": null, - "name": "Concatenate datasets", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "bottom": 1640.1158095851088, - "height": 47.50457763671875, - "left": 2223.5240589488635, - "right": 2289.5240589488635, - "top": 1592.61123194839, - "width": 66, - "x": 2223.5240589488635, - "y": 1592.61123194839 - }, - "post_job_actions": {}, - "tool_id": "cat1", - "tool_state": "{\"__input_ext\": \"fasta\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", - "type": "tool", - "uuid": "dda3d7b0-3279-46af-93e6-2e2fd2024204", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_file1", - "uuid": "f6175082-e57c-46c5-a990-3e2b249c1e46" - } - ] - }, - "38": { - "annotation": "", - "content_id": "cat1", - "errors": null, - "id": 38, - "input_connections": { - "input1": { - "id": 35, - "output_name": "ngs_contigs_scaffold_trimmed" - }, - "queries_0|input2": { - "id": 35, - "output_name": "ngs_contigs_not_scaffolded_trimmed" - } - }, - "inputs": [], - "label": null, - "name": "Concatenate datasets", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "bottom": 1103.1158049612334, - "height": 47.504547119140625, - "left": 2511.5241773200755, - "right": 2577.5241773200755, - "top": 1055.6112578420928, - "width": 66, - "x": 2511.5241773200755, - "y": 1055.6112578420928 - }, - "post_job_actions": {}, - "tool_id": "cat1", - "tool_state": "{\"__input_ext\": \"fasta\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0.0", - "type": "tool", - "uuid": "13317723-c405-4c9c-81e6-d5d00ad22538", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_file1", - "uuid": "db4e650f-ff13-4914-bc5d-dbd31c1cc4d8" - } - ] - }, - "39": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 39, - "input_connections": { - "function_select|input": { - "id": 37, - "output_name": "out_file1" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - } - ], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "split_fasta", - "type": "fasta" - } - ], - "position": { - "bottom": 1638.5290323893228, - "height": 50.93341064453125, - "left": 2511.5241773200755, - "right": 2577.5241773200755, - "top": 1587.5956217447915, - "width": 66, - "x": 2511.5241773200755, - "y": 1587.5956217447915 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"function_select\": {\"functions\": \"split_fa\", \"__current_case__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "af48d338-441a-42e0-af04-8e64891e51b8", - "workflow_outputs": [ - { - "label": null, - "output_name": "split_fasta", - "uuid": "adb872ff-ece3-4e01-a940-366fbabaf36b" - } - ] - }, - "40": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "errors": null, - "id": 40, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 6, - "output_name": "output" - }, - "reference_source|ref_file": { - "id": 37, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Map with minimap2", - "outputs": [ - { - "name": "alignment_output", - "type": "bam" - } - ], - "position": { - "bottom": 1909.0158173532195, - "height": 74.420166015625, - "left": 2511.5241773200755, - "right": 2577.5241773200755, - "top": 1834.5956513375945, - "width": 66, - "x": 2511.5241773200755, - "y": 1834.5956513375945 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "tool_shed_repository": { - "changeset_revision": "11a0d50a54e6", - "name": "minimap2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": \"true\"}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"asm5\"}, \"indexing_options\": {\"H\": \"false\", \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": \"false\", \"L\": \"false\", \"K\": null, \"cs\": null, \"c\": \"false\", \"eqx\": \"false\", \"Y\": \"false\"}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": \"false\", \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.24+galaxy0", - "type": "tool", - "uuid": "1d14b2d9-f019-4502-a063-562af76a08ae", - "workflow_outputs": [ - { - "label": null, - "output_name": "alignment_output", - "uuid": "903e5888-3e07-428a-b5fa-24da623530d8" - } - ] - }, - "41": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "errors": null, - "id": 41, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 0, - "output_name": "output" - }, - "reference_source|ref_file": { - "id": 38, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Map with BWA-MEM", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "bottom": 757.7603140166311, - "height": 81.14907836914062, - "left": 2809.508537523674, - "right": 2875.508537523674, - "top": 676.6112356474905, - "width": 66, - "x": 2809.508537523674, - "y": 676.6112356474905 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "tool_shed_repository": { - "changeset_revision": "64f11cf59c6e", - "name": "bwa", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"fasta\", \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.7.17.2", - "type": "tool", - "uuid": "ecfda239-f364-433a-afa3-3281c11d0f24", - "workflow_outputs": [ - { - "label": null, - "output_name": "bam_output", - "uuid": "69b7db14-b48a-40a0-9e89-6f95ba1dd63b" - } - ] - }, - "42": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "errors": null, - "id": 42, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 1, - "output_name": "output" - }, - "reference_source|ref_file": { - "id": 38, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Map with BWA-MEM", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "bottom": 1041.7447509765625, - "height": 81.1490478515625, - "left": 2809.508537523674, - "right": 2875.508537523674, - "top": 960.595703125, - "width": 66, - "x": 2809.508537523674, - "y": 960.595703125 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "tool_shed_repository": { - "changeset_revision": "64f11cf59c6e", - "name": "bwa", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"fasta\", \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.7.17.2", - "type": "tool", - "uuid": "9dd81280-dc44-44e0-8ed1-a470d6c6dc6f", - "workflow_outputs": [ - { - "label": null, - "output_name": "bam_output", - "uuid": "f7d1e802-955c-4fbb-bb1b-d0b9e03aa24a" - } - ] - }, - "43": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", - "errors": null, - "id": 43, - "input_connections": { - "infile": { - "id": 38, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Replace", - "outputs": [ - { - "name": "outfile", - "type": "input" - } - ], - "position": { - "bottom": 1209.3579813639321, - "height": 30.746734619140625, - "left": 3087.524229107481, - "right": 3153.5242901426373, - "top": 1178.6112467447915, - "width": 66.00006103515625, - "x": 3087.524229107481, - "y": 1178.6112467447915 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/1.1.3", - "tool_shed_repository": { - "changeset_revision": "ddf54b12c295", - "name": "text_processing", - "owner": "bgruening", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"fasta\", \"caseinsensitive\": \"false\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"find_pattern\": \":\", \"global\": \"true\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"is_regex\": \"false\", \"replace_pattern\": \"\", \"searchwhere\": {\"searchwhere_select\": \"line\", \"__current_case__\": 0}, \"skip_first_line\": \"false\", \"wholewords\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.1.3", - "type": "tool", - "uuid": "cf9b2414-81fd-4bbd-b478-b81fe7a71c20", - "workflow_outputs": [ - { - "label": null, - "output_name": "outfile", - "uuid": "90c175ad-a531-470f-ade0-930e908c372b" - } - ] - }, - "44": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "errors": null, - "id": 44, - "input_connections": { - "assembly|ref|est_ref_size": { - "id": 24, - "output_name": "integer_param" - }, - "in|inputs_0|input": { - "id": 38, - "output_name": "out_file1" - }, - "reads|input_1": { - "id": 6, - "output_name": "output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Quast", - "name": "reads" - } - ], - "label": null, - "name": "Quast", - "outputs": [ - { - "name": "report_html", - "type": "html" - } - ], - "position": { - "bottom": 2381.06035082268, - "height": 84.4490966796875, - "left": 2809.508537523674, - "right": 2875.508537523674, - "top": 2296.6112541429925, - "width": 66, - "x": 2809.508537523674, - "y": 2296.6112541429925 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "tool_shed_repository": { - "changeset_revision": "875d0f36d66f", - "name": "quast", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"advanced\": {\"contig_thresholds\": \"0,1000\", \"strict_NA\": \"false\", \"extensive_mis_size\": \"1000\", \"scaffold_gap_max_size\": \"1000\", \"unaligned_part_size\": \"500\", \"skip_unaligned_mis_contigs\": \"true\", \"fragmented_max_indent\": null}, \"alignments\": {\"use_all_alignments\": \"false\", \"min_alignment\": \"65\", \"min_identity\": \"95.0\", \"ambiguity_usage\": \"one\", \"ambiguity_score\": \"0.99\", \"fragmented\": \"false\", \"upper_bound_assembly\": \"false\", \"upper_bound_min_con\": null}, \"assembly\": {\"type\": \"genome\", \"__current_case__\": 0, \"ref\": {\"use_ref\": \"false\", \"__current_case__\": 1, \"est_ref_size\": {\"__class__\": \"ConnectedValue\"}}, \"orga_type\": \"--eukaryote\"}, \"genes\": {\"gene_finding\": {\"tool\": \"none\", \"__current_case__\": 0}, \"rna_finding\": \"false\", \"conserved_genes_finding\": \"false\"}, \"in\": {\"custom\": \"true\", \"__current_case__\": 0, \"inputs\": [{\"__index__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}, \"labels\": \"Primary assembly\"}]}, \"large\": \"false\", \"min_contig\": \"500\", \"output_files\": [\"html\"], \"reads\": {\"reads_option\": \"pacbio\", \"__current_case__\": 5, \"input_1\": {\"__class__\": \"RuntimeValue\"}}, \"split_scaffolds\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.0.2+galaxy4", - "type": "tool", - "uuid": "a584815c-1223-466b-bfd2-4ee7d2b26023", - "workflow_outputs": [ - { - "label": null, - "output_name": "report_html", - "uuid": "47a2b9b0-2eda-4624-a800-215b1744534b" - } - ] - }, - "45": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "errors": null, - "id": 45, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 39, - "output_name": "split_fasta" - }, - "reference_source|ref_file": { - "id": 39, - "output_name": "split_fasta" - } - }, - "inputs": [], - "label": null, - "name": "Map with minimap2", - "outputs": [ - { - "name": "alignment_output", - "type": "bam" - } - ], - "position": { - "bottom": 1662.0157877604165, - "height": 74.420166015625, - "left": 2809.508537523674, - "right": 2875.508537523674, - "top": 1587.5956217447915, - "width": 66, - "x": 2809.508537523674, - "y": 1587.5956217447915 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", - "tool_shed_repository": { - "changeset_revision": "11a0d50a54e6", - "name": "minimap2", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": \"true\"}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"self-homology\"}, \"indexing_options\": {\"H\": \"false\", \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": \"false\", \"L\": \"false\", \"K\": null, \"cs\": null, \"c\": \"false\", \"eqx\": \"false\", \"Y\": \"false\"}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": \"false\", \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.24+galaxy0", - "type": "tool", - "uuid": "9d7527a9-c076-4a3d-ba6a-1f7aff53e279", - "workflow_outputs": [ - { - "label": null, - "output_name": "alignment_output", - "uuid": "d1d01a87-598d-401f-9127-6b3858b3c586" - } - ] - }, - "46": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 46, - "input_connections": { - "function_select|input": { - "id": 40, - "output_name": "alignment_output" - }, - "function_select|section_calcuts|transition": { - "id": 17, - "output_name": "integer_param" - }, - "function_select|section_calcuts|upper_depth": { - "id": 18, - "output_name": "integer_param" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - } - ], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "pbcstat_cov", - "type": "tabular" - }, - { - "name": "hist", - "type": "png" - }, - { - "name": "calcuts_cutoff", - "type": "tabular" - } - ], - "position": { - "bottom": 1976.304931640625, - "height": 124.693603515625, - "left": 2809.508537523674, - "right": 2875.508537523674, - "top": 1851.611328125, - "width": 66, - "x": 2809.508537523674, - "y": 1851.611328125 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"function_select\": {\"functions\": \"pbcstat\", \"__current_case__\": 2, \"input\": {\"__class__\": \"RuntimeValue\"}, \"pbcstat_options\": {\"max_cov\": \"500\", \"min_map_ratio\": \"0.0\", \"min_map_qual\": null, \"flank\": \"0\", \"primary_alignments\": \"true\"}, \"section_calcuts\": {\"min_depth\": \"0.1\", \"low_depth\": null, \"transition\": {\"__class__\": \"ConnectedValue\"}, \"upper_depth\": {\"__class__\": \"ConnectedValue\"}, \"ploidy\": \"-d 0\"}, \"section_hist\": {\"ymin\": null, \"ymax\": null, \"xmin\": null, \"xmax\": null, \"title\": \"Read depth histogram plot\"}, \"output_options\": [\"pbcstat_coverage\", \"histogram\", \"calcuts_cutoff\"]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "ef0a97be-df6f-4929-877d-d5d6ffe5385e", - "workflow_outputs": [ - { - "label": null, - "output_name": "pbcstat_cov", - "uuid": "52fa2145-438b-4352-b857-47f121110285" - }, - { - "label": null, - "output_name": "hist", - "uuid": "80c91e05-93c4-4704-8618-04d6e35a1cf0" - }, - { - "label": null, - "output_name": "calcuts_cutoff", - "uuid": "9a818a87-68b1-464c-9380-f939fd4cb7d1" - } - ] - }, - "47": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", - "errors": null, - "id": 47, - "input_connections": { - "forward": { - "id": 41, - "output_name": "bam_output" - }, - "reverse": { - "id": 42, - "output_name": "bam_output" - } - }, - "inputs": [], - "label": null, - "name": "Filter and merge", - "outputs": [ - { - "name": "outfile", - "type": "bam" - } - ], - "position": { - "bottom": 893.0845845540364, - "height": 47.504547119140625, - "left": 3087.524229107481, - "right": 3153.5242901426373, - "top": 845.5800374348958, - "width": 66.00006103515625, - "x": 3087.524229107481, - "y": 845.5800374348958 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", - "tool_shed_repository": { - "changeset_revision": "25ca5d73aedf", - "name": "bellerophon", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"forward\": {\"__class__\": \"ConnectedValue\"}, \"quality\": \"20\", \"reverse\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0+galaxy0", - "type": "tool", - "uuid": "e330090d-e993-4b51-8d83-38cb7c7d6d82", - "workflow_outputs": [ - { - "label": null, - "output_name": "outfile", - "uuid": "9e94432d-64b1-43fa-bc0b-29a9701fa132" - } - ] - }, - "48": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 48, - "input_connections": { - "function_select|coverage": { - "id": 46, - "output_name": "pbcstat_cov" - }, - "function_select|cutoffs": { - "id": 46, - "output_name": "calcuts_cutoff" - }, - "function_select|input": { - "id": 45, - "output_name": "alignment_output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - }, - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - }, - { - "description": "runtime parameter for tool Purge overlaps", - "name": "function_select" - } - ], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "purge_dups_bed", - "type": "bed" - } - ], - "position": { - "bottom": 1910.5712761156485, - "height": 70.99127197265625, - "left": 3084.4772801254735, - "right": 3150.4772190903172, - "top": 1839.5800041429923, - "width": 65.99993896484375, - "x": 3084.4772801254735, - "y": 1839.5800041429923 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"function_select\": {\"functions\": \"purge_dups\", \"__current_case__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}, \"coverage\": {\"__class__\": \"RuntimeValue\"}, \"cutoffs\": {\"__class__\": \"RuntimeValue\"}, \"min_bad\": \"0.8\", \"min_align\": \"70\", \"min_match\": \"200\", \"min_chain\": \"500\", \"max_gap\": \"20000\", \"double_chain\": {\"chaining_rounds\": \"one\", \"__current_case__\": 1}, \"min_chain_score\": \"10000\", \"max_extend\": \"15000\", \"log_file\": \"false\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "aab90c1f-06d8-4146-bf54-13cb5f7abb6c", - "workflow_outputs": [ - { - "label": null, - "output_name": "purge_dups_bed", - "uuid": "d50c11ea-dcb1-4500-8f41-67baa1258d5d" - } - ] - }, - "49": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", - "errors": null, - "id": 49, - "input_connections": { - "input": { - "id": 47, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "PretextMap", - "outputs": [ - { - "name": "pretext_map_out", - "type": "pretext" - } - ], - "position": { - "bottom": 722.8001773718631, - "height": 44.204559326171875, - "left": 3365.524384469697, - "right": 3431.524384469697, - "top": 678.5956180456913, - "width": 66, - "x": 3365.524384469697, - "y": 678.5956180456913 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", - "tool_shed_repository": { - "changeset_revision": "dfb8a4497339", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"10\", \"sorting\": {\"sortby\": \"nosort\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.9+galaxy0", - "type": "tool", - "uuid": "391244e8-1cea-4bc0-9710-e7a23e88d3f3", - "workflow_outputs": [ - { - "label": null, - "output_name": "pretext_map_out", - "uuid": "2a24aa1c-6b47-4eab-ab6a-314e1ee9a899" - } - ] - }, - "50": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", - "errors": null, - "id": 50, - "input_connections": { - "input": { - "id": 47, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "bedtools BAM to BED", - "outputs": [ - { - "name": "output", - "type": "bed" - } - ], - "position": { - "bottom": 894.800176447088, - "height": 44.20452880859375, - "left": 3365.524384469697, - "right": 3431.524384469697, - "top": 850.5956476384943, - "width": 66, - "x": 3365.524384469697, - "y": 850.5956476384943 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", - "tool_shed_repository": { - "changeset_revision": "7ab85ac5f64b", - "name": "bedtools", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"ed_score\": \"false\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"-bed12\", \"split\": \"false\", \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.30.0+galaxy2", - "type": "tool", - "uuid": "84331994-3df0-4e1f-8ab4-f2cdcb798351", - "workflow_outputs": [ - { - "label": null, - "output_name": "output", - "uuid": "06d76a1c-47d1-41c8-b9c1-6637bcd8278a" - } - ] - }, - "51": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "errors": null, - "id": 51, - "input_connections": { - "function_select|bed_input": { - "id": 48, - "output_name": "purge_dups_bed" - }, - "function_select|fasta_input": { - "id": 37, - "output_name": "out_file1" - } - }, - "inputs": [], - "label": null, - "name": "Purge overlaps", - "outputs": [ - { - "name": "get_seqs_hap", - "type": "fasta" - }, - { - "name": "get_seqs_purged", - "type": "fasta" - } - ], - "position": { - "bottom": 1592.0603656190813, - "height": 84.4490966796875, - "left": 3365.524384469697, - "right": 3431.524384469697, - "top": 1507.6112689393938, - "width": 66, - "x": 3365.524384469697, - "y": 1507.6112689393938 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.5+galaxy4", - "tool_shed_repository": { - "changeset_revision": "a315c25dc813", - "name": "purge_dups", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"function_select\": {\"functions\": \"get_seqs\", \"__current_case__\": 5, \"fasta_input\": {\"__class__\": \"ConnectedValue\"}, \"bed_input\": {\"__class__\": \"ConnectedValue\"}, \"advanced_options\": {\"coverage\": \"false\", \"haplotigs\": \"false\", \"length\": \"10000\", \"min_ratio\": \"0.05\", \"end_trim\": \"true\", \"split\": \"false\", \"min_gap\": \"10000\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.5+galaxy4", - "type": "tool", - "uuid": "3b6f995a-5b7a-4669-9bad-0bc980555b50", - "workflow_outputs": [ - { - "label": null, - "output_name": "get_seqs_hap", - "uuid": "4575d989-6648-4968-a0f0-b172e1995fa2" - }, - { - "label": null, - "output_name": "get_seqs_purged", - "uuid": "58175e84-7757-40fa-bbb1-96c88c5728e9" - } - ] - }, - "52": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", - "errors": null, - "id": 52, - "input_connections": { - "input": { - "id": 49, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": null, - "name": "Pretext Snapshot", - "outputs": [ - { - "name": "pretext_snap_out", - "type": "input" - } - ], - "position": { - "bottom": 742.8157940488873, - "height": 44.20452880859375, - "left": 3643.524354876894, - "right": 3709.524354876894, - "top": 698.6112652402935, - "width": 66, - "x": 3643.524354876894, - "y": 698.6112652402935 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", - "tool_shed_repository": { - "changeset_revision": "44c66e8d21e6", - "name": "pretext_snapshot", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"colormap\": \"5\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"true\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"1000\", \"sequencenames\": \"false\", \"sequences\": \"=full, =all\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.0.3+galaxy1", - "type": "tool", - "uuid": "0748eba5-6679-4049-93a8-387f97d0f062", - "workflow_outputs": [ - { - "label": null, - "output_name": "pretext_snap_out", - "uuid": "0b1d8b2a-dbf4-4ee2-b118-cb4afd53ddd5" - } - ] - }, - "53": { - "annotation": "", - "content_id": "sort1", - "errors": null, - "id": 53, - "input_connections": { - "input": { - "id": 50, - "output_name": "output" - } - }, - "inputs": [], - "label": null, - "name": "Sort", - "outputs": [ - { - "name": "out_file1", - "type": "input" - } - ], - "position": { - "bottom": 901.3267720540364, - "height": 30.746734619140625, - "left": 3643.524354876894, - "right": 3709.524354876894, - "top": 870.5800374348958, - "width": 66, - "x": 3643.524354876894, - "y": 870.5800374348958 - }, - "post_job_actions": {}, - "tool_id": "sort1", - "tool_state": "{\"__input_ext\": \"bed\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"column\": \"4\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"ASC\", \"style\": \"alpha\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.2.0", - "type": "tool", - "uuid": "699917c5-4c0e-429a-9cb9-e7c3211a8489", - "workflow_outputs": [ - { - "label": null, - "output_name": "out_file1", - "uuid": "237a5c4a-d28c-4370-ab5c-1eca7a08ea21" - } - ] - }, - "54": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "errors": null, - "id": 54, - "input_connections": { - "input": { - "id": 51, - "output_name": "get_seqs_purged" - } - }, - "inputs": [], - "label": null, - "name": "Busco", - "outputs": [ - { - "name": "busco_sum", - "type": "txt" - }, - { - "name": "busco_table", - "type": "tabular" - } - ], - "position": { - "bottom": 1069.3025512695312, - "height": 67.69122314453125, - "left": 3643.524354876894, - "right": 3709.524354876894, - "top": 1001.611328125, - "width": 66, - "x": 3643.524354876894, - "y": 1001.611328125 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "46ae58b1d792", - "name": "busco", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"saccharomycetes_odb10\"}, \"outputs\": [\"short_summary\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.2.2+galaxy2", - "type": "tool", - "uuid": "abe77b25-0bed-4ac9-a243-ec6fd0637446", - "workflow_outputs": [ - { - "label": null, - "output_name": "busco_table", - "uuid": "77118f8a-dfc0-4f4f-9767-3047ed5a846a" - }, - { - "label": null, - "output_name": "busco_sum", - "uuid": "fdd21f9e-463f-4f44-9fe7-894edb33e106" - } - ] - }, - "55": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "errors": null, - "id": 55, - "input_connections": { - "assembly|ref|est_ref_size": { - "id": 24, - "output_name": "integer_param" - }, - "in|inputs_0|input": { - "id": 34, - "output_name": "get_seqs_purged" - }, - "in|inputs_1|input": { - "id": 51, - "output_name": "get_seqs_purged" - }, - "reads|input_1": { - "id": 6, - "output_name": "output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Quast", - "name": "reads" - } - ], - "label": null, - "name": "Quast", - "outputs": [ - { - "name": "report_html", - "type": "html" - } - ], - "position": { - "bottom": 2169.7868744821258, - "height": 101.20684814453125, - "left": 3643.524354876894, - "right": 3709.524354876894, - "top": 2068.5800263375945, - "width": 66, - "x": 3643.524354876894, - "y": 2068.5800263375945 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "tool_shed_repository": { - "changeset_revision": "875d0f36d66f", - "name": "quast", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"advanced\": {\"contig_thresholds\": \"0,1000\", \"strict_NA\": \"false\", \"extensive_mis_size\": \"1000\", \"scaffold_gap_max_size\": \"1000\", \"unaligned_part_size\": \"500\", \"skip_unaligned_mis_contigs\": \"true\", \"fragmented_max_indent\": null}, \"alignments\": {\"use_all_alignments\": \"false\", \"min_alignment\": \"65\", \"min_identity\": \"95.0\", \"ambiguity_usage\": \"one\", \"ambiguity_score\": \"0.99\", \"fragmented\": \"false\", \"upper_bound_assembly\": \"false\", \"upper_bound_min_con\": null}, \"assembly\": {\"type\": \"genome\", \"__current_case__\": 0, \"ref\": {\"use_ref\": \"false\", \"__current_case__\": 1, \"est_ref_size\": {\"__class__\": \"ConnectedValue\"}}, \"orga_type\": \"--eukaryote\"}, \"genes\": {\"gene_finding\": {\"tool\": \"none\", \"__current_case__\": 0}, \"rna_finding\": \"false\", \"conserved_genes_finding\": \"false\"}, \"in\": {\"custom\": \"true\", \"__current_case__\": 0, \"inputs\": [{\"__index__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}, \"labels\": \"Primary assembly\"}, {\"__index__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}, \"labels\": \"Alternate assembly\"}]}, \"large\": \"false\", \"min_contig\": \"500\", \"output_files\": [\"html\"], \"reads\": {\"reads_option\": \"pacbio\", \"__current_case__\": 5, \"input_1\": {\"__class__\": \"RuntimeValue\"}}, \"split_scaffolds\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.0.2+galaxy4", - "type": "tool", - "uuid": "da02cb47-cd47-463e-81c2-061ecaf19b20", - "workflow_outputs": [ - { - "label": null, - "output_name": "report_html", - "uuid": "b5a3f213-36f5-4f1e-aa77-ea4a2c4cb07e" - } - ] - }, - "56": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/salsa/salsa/2.3+galaxy2", - "errors": null, - "id": 56, - "input_connections": { - "bed_file": { - "id": 53, - "output_name": "out_file1" - }, - "fasta_in": { - "id": 43, - "output_name": "outfile" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool SALSA", - "name": "bed_file" - }, - { - "description": "runtime parameter for tool SALSA", - "name": "fasta_in" - }, - { - "description": "runtime parameter for tool SALSA", - "name": "gfa_file" - } - ], - "label": null, - "name": "SALSA", - "outputs": [ - { - "name": "scaffolds_fasta", - "type": "fasta" - }, - { - "name": "scaffolds_agp", - "type": "tabular" - } - ], - "position": { - "bottom": 957.3446988192471, - "height": 87.74908447265625, - "left": 3921.5243252840905, - "right": 3987.5243252840905, - "top": 869.5956143465909, - "width": 66, - "x": 3921.5243252840905, - "y": 869.5956143465909 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/salsa/salsa/2.3+galaxy2", - "tool_shed_repository": { - "changeset_revision": "f77f7a7f3b83", - "name": "salsa", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"cutoff\": null, \"enzyme_conditional\": {\"enzyme_options\": \"specific\", \"__current_case__\": 1, \"manual_enzyme\": \"CTTAAG\"}, \"fasta_in\": {\"__class__\": \"RuntimeValue\"}, \"gfa_file\": {\"__class__\": \"RuntimeValue\"}, \"iter\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "2.3+galaxy2", - "type": "tool", - "uuid": "1b9f99a2-f931-4782-8bc1-44ba522a33a0", - "workflow_outputs": [ - { - "label": null, - "output_name": "scaffolds_fasta", - "uuid": "81f8bb38-a485-4f59-be03-089601221e7d" - }, - { - "label": null, - "output_name": "scaffolds_agp", - "uuid": "553b0bf4-90c9-40b8-8e76-ed5b49c39f84" - } - ] - }, - "57": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "errors": null, - "id": 57, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 0, - "output_name": "output" - }, - "reference_source|ref_file": { - "id": 56, - "output_name": "scaffolds_fasta" - } - }, - "inputs": [], - "label": null, - "name": "Map with BWA-MEM", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "bottom": 632.7447162974964, - "height": 81.14906311035156, - "left": 4209.524073745265, - "right": 4275.524073745265, - "top": 551.5956531871449, - "width": 66, - "x": 4209.524073745265, - "y": 551.5956531871449 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "tool_shed_repository": { - "changeset_revision": "64f11cf59c6e", - "name": "bwa", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"fasta\", \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.7.17.2", - "type": "tool", - "uuid": "f5bb38bd-a0aa-4439-a4c6-801f47366610", - "workflow_outputs": [ - { - "label": null, - "output_name": "bam_output", - "uuid": "e593f0ce-7349-4008-b896-a4c68806f50c" - } - ] - }, - "58": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "errors": null, - "id": 58, - "input_connections": { - "fastq_input|fastq_input1": { - "id": 1, - "output_name": "output" - }, - "reference_source|ref_file": { - "id": 56, - "output_name": "scaffolds_fasta" - } - }, - "inputs": [], - "label": null, - "name": "Map with BWA-MEM", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "bottom": 916.7447509765625, - "height": 81.1490478515625, - "left": 4209.524073745265, - "right": 4275.524073745265, - "top": 835.595703125, - "width": 66, - "x": 4209.524073745265, - "y": 835.595703125 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2", - "tool_shed_repository": { - "changeset_revision": "64f11cf59c6e", - "name": "bwa", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"fasta\", \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.7.17.2", - "type": "tool", - "uuid": "daacf6aa-0784-468f-8b6f-59f67ebe590a", - "workflow_outputs": [ - { - "label": null, - "output_name": "bam_output", - "uuid": "de6cbec3-7873-4027-aeec-7754b512665b" - } - ] - }, - "59": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "errors": null, - "id": 59, - "input_connections": { - "input": { - "id": 56, - "output_name": "scaffolds_fasta" - } - }, - "inputs": [], - "label": null, - "name": "Busco", - "outputs": [ - { - "name": "busco_sum", - "type": "txt" - }, - { - "name": "busco_table", - "type": "tabular" - } - ], - "position": { - "bottom": 1187.2868680087001, - "height": 67.69125366210938, - "left": 4209.524073745265, - "right": 4275.524073745265, - "top": 1119.5956143465908, - "width": 66, - "x": 4209.524073745265, - "y": 1119.5956143465908 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.2.2+galaxy2", - "tool_shed_repository": { - "changeset_revision": "46ae58b1d792", - "name": "busco", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"saccharomycetes_odb10\"}, \"outputs\": [\"short_summary\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.2.2+galaxy2", - "type": "tool", - "uuid": "87b52b5f-bac9-4a63-aed0-0535a1e4171d", - "workflow_outputs": [ - { - "label": null, - "output_name": "busco_sum", - "uuid": "32dca78e-789b-4654-9869-fdc1679d1802" - }, - { - "label": null, - "output_name": "busco_table", - "uuid": "d42b5539-a486-485b-a84b-254cd0dd7910" - } - ] - }, - "60": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "errors": null, - "id": 60, - "input_connections": { - "assembly|ref|est_ref_size": { - "id": 24, - "output_name": "integer_param" - }, - "in|inputs_0|input": { - "id": 56, - "output_name": "scaffolds_fasta" - }, - "reads|input_1": { - "id": 6, - "output_name": "output" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Quast", - "name": "reads" - } - ], - "label": null, - "name": "Quast", - "outputs": [ - { - "name": "report_html", - "type": "html" - } - ], - "position": { - "bottom": 2512.0602916370735, - "height": 84.4490966796875, - "left": 4209.524073745265, - "right": 4275.524073745265, - "top": 2427.611194957386, - "width": 66, - "x": 4209.524073745265, - "y": 2427.611194957386 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/quast/quast/5.0.2+galaxy4", - "tool_shed_repository": { - "changeset_revision": "875d0f36d66f", - "name": "quast", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"advanced\": {\"contig_thresholds\": \"0,1000\", \"strict_NA\": \"false\", \"extensive_mis_size\": \"1000\", \"scaffold_gap_max_size\": \"1000\", \"unaligned_part_size\": \"500\", \"skip_unaligned_mis_contigs\": \"true\", \"fragmented_max_indent\": null}, \"alignments\": {\"use_all_alignments\": \"false\", \"min_alignment\": \"65\", \"min_identity\": \"95.0\", \"ambiguity_usage\": \"one\", \"ambiguity_score\": \"0.99\", \"fragmented\": \"false\", \"upper_bound_assembly\": \"false\", \"upper_bound_min_con\": null}, \"assembly\": {\"type\": \"genome\", \"__current_case__\": 0, \"ref\": {\"use_ref\": \"false\", \"__current_case__\": 1, \"est_ref_size\": {\"__class__\": \"ConnectedValue\"}}, \"orga_type\": \"--eukaryote\"}, \"genes\": {\"gene_finding\": {\"tool\": \"none\", \"__current_case__\": 0}, \"rna_finding\": \"false\", \"conserved_genes_finding\": \"false\"}, \"in\": {\"custom\": \"true\", \"__current_case__\": 0, \"inputs\": [{\"__index__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}, \"labels\": \"Primary assembly\"}]}, \"large\": \"false\", \"min_contig\": \"500\", \"output_files\": [\"html\"], \"reads\": {\"reads_option\": \"pacbio\", \"__current_case__\": 5, \"input_1\": {\"__class__\": \"RuntimeValue\"}}, \"split_scaffolds\": \"false\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "5.0.2+galaxy4", - "type": "tool", - "uuid": "becc24fe-7b91-49d4-928a-2509b9e0f523", - "workflow_outputs": [ - { - "label": null, - "output_name": "report_html", - "uuid": "646cde64-76b7-40d5-ad5d-fe1fb856306a" - } - ] - }, - "61": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", - "errors": null, - "id": 61, - "input_connections": { - "forward": { - "id": 57, - "output_name": "bam_output" - }, - "reverse": { - "id": 58, - "output_name": "bam_output" - } - }, - "inputs": [], - "label": null, - "name": "Filter and merge", - "outputs": [ - { - "name": "outfile", - "type": "bam" - } - ], - "position": { - "bottom": 677.0845577355586, - "height": 47.5045166015625, - "left": 4487.524044152462, - "right": 4553.524044152462, - "top": 629.5800411339961, - "width": 66, - "x": 4487.524044152462, - "y": 629.5800411339961 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", - "tool_shed_repository": { - "changeset_revision": "25ca5d73aedf", - "name": "bellerophon", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"forward\": {\"__class__\": \"ConnectedValue\"}, \"quality\": \"20\", \"reverse\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "1.0+galaxy0", - "type": "tool", - "uuid": "a3b4e573-b9e3-4d5e-9557-93ec3e153e62", - "workflow_outputs": [ - { - "label": null, - "output_name": "outfile", - "uuid": "999b7fa7-1b39-48fd-afb8-31498c4d0c20" - } - ] - }, - "62": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", - "errors": null, - "id": 62, - "input_connections": { - "input": { - "id": 61, - "output_name": "outfile" - } - }, - "inputs": [], - "label": null, - "name": "PretextMap", - "outputs": [ - { - "name": "pretext_map_out", - "type": "pretext" - } - ], - "position": { - "bottom": 678.8001801461884, - "height": 44.20452880859375, - "left": 4765.524014559659, - "right": 4831.524014559659, - "top": 634.5956513375946, - "width": 66, - "x": 4765.524014559659, - "y": 634.5956513375946 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", - "tool_shed_repository": { - "changeset_revision": "dfb8a4497339", - "name": "pretext_map", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"10\", \"sorting\": {\"sortby\": \"nosort\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.1.9+galaxy0", - "type": "tool", - "uuid": "063a413a-2760-47be-b4a4-215eed48a2f7", - "workflow_outputs": [ - { - "label": null, - "output_name": "pretext_map_out", - "uuid": "658447e1-83da-4a2a-b2dd-0d6c219e2e05" - } - ] - }, - "63": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", - "errors": null, - "id": 63, - "input_connections": { - "input": { - "id": 62, - "output_name": "pretext_map_out" - } - }, - "inputs": [], - "label": null, - "name": "Pretext Snapshot", - "outputs": [ - { - "name": "pretext_snap_out", - "type": "input" - } - ], - "position": { - "bottom": 703.8001801461884, - "height": 44.20452880859375, - "left": 5043.492912523674, - "right": 5109.492912523674, - "top": 659.5956513375946, - "width": 66, - "x": 5043.492912523674, - "y": 659.5956513375946 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", - "tool_shed_repository": { - "changeset_revision": "44c66e8d21e6", - "name": "pretext_snapshot", - "owner": "iuc", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/opt/galaxy/tool-data/shared/ucsc/chrom/?.len\", \"colormap\": \"5\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"true\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"1000\", \"sequencenames\": \"false\", \"sequences\": \"=full, =all\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", - "tool_version": "0.0.3+galaxy1", - "type": "tool", - "uuid": "08c9443e-c104-4d78-bdad-900fa8b1baf4", - "workflow_outputs": [ - { - "label": null, - "output_name": "pretext_snap_out", - "uuid": "58cdd2e1-4049-419b-8639-24fe288cc2dd" - } - ] - } - }, - "tags": ["assembly"], - "uuid": "16f91f3c-8354-4384-bc27-8adf963fe030", - "version": 9 -} \ No newline at end of file diff --git a/topics/assembly/tutorials/vgp_workflow_training/workflows/wf1-kmer-profiling-hifi.ga b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf1-kmer-profiling-hifi.ga new file mode 100644 index 00000000000000..47930adc2b2193 --- /dev/null +++ b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf1-kmer-profiling-hifi.ga @@ -0,0 +1,407 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "", + "creator": [ + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + }, + { + "class": "Organization", + "name": "Galaxy" + } + ], + "format-version": "0.1", + "license": "CC-BY-4.0", + "release": "0.1.1", + "name": "kmer-profiling-hifi-VGP1", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Collection of Pacbio Data" + } + ], + "label": "Collection of Pacbio Data", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 25.07814953674619, + "top": 0 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "861c3a49-1055-4030-9a91-e53cbf1ac436", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "K-mer length " + } + ], + "label": "K-mer length ", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 0, + "top": 290.01566057828205 + }, + "tool_id": null, + "tool_state": "{\"default\": 21, \"parameter_type\": \"integer\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "946bcadd-8ab0-4595-9985-abb574539844", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Ploidy" + } + ], + "label": "Ploidy", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 16.37496564855541, + "top": 493.99999877316264 + }, + "tool_id": null, + "tool_state": "{\"default\": 2, \"parameter_type\": \"integer\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "e3848560-55a2-42a5-ac1a-487ccf084d92", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy6", + "errors": null, + "id": 3, + "input_connections": { + "operation_type|input_reads": { + "id": 0, + "output_name": "output" + }, + "operation_type|options_kmer_size|input_kmer_size": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Meryl", + "outputs": [ + { + "name": "read_db", + "type": "meryldb" + } + ], + "position": { + "left": 326.0155759265076, + "top": 0.9843835878612026 + }, + "post_job_actions": { + "HideDatasetActionread_db": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "read_db" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "29dabd8db6f2", + "name": "meryl", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"operation_type\": {\"command_type\": \"count-kmers\", \"__current_case__\": 0, \"count_operations\": \"count\", \"input_reads\": {\"__class__\": \"ConnectedValue\"}, \"options_kmer_size\": {\"kmer_size\": \"provide\", \"__current_case__\": 0, \"input_kmer_size\": {\"__class__\": \"ConnectedValue\"}}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3+galaxy6", + "type": "tool", + "uuid": "9f3718fe-c33a-43c1-b36e-964a929678f7", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy6", + "errors": null, + "id": 4, + "input_connections": { + "operation_type|input_meryldb_02": { + "id": 3, + "output_name": "read_db" + } + }, + "inputs": [], + "label": null, + "name": "Meryl", + "outputs": [ + { + "name": "read_db", + "type": "meryldb" + } + ], + "position": { + "left": 594.7968602779522, + "top": 127.82813604153586 + }, + "post_job_actions": { + "TagDatasetActionread_db": { + "action_arguments": { + "tags": "meryl_db,Meryl Database" + }, + "action_type": "TagDatasetAction", + "output_name": "read_db" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "29dabd8db6f2", + "name": "meryl", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"operation_type\": {\"command_type\": \"groups-kmers\", \"__current_case__\": 3, \"groups_operations\": \"union-sum\", \"input_meryldb_02\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3+galaxy6", + "type": "tool", + "uuid": "6467a6da-23e0-4ee0-af0e-7f5fc8a636de", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Meryl Database", + "output_name": "read_db", + "uuid": "9055fdc0-d158-435e-b662-e5a4f2766b42" + } + ] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy6", + "errors": null, + "id": 5, + "input_connections": { + "operation_type|input_meryldb_02": { + "id": 4, + "output_name": "read_db" + } + }, + "inputs": [], + "label": null, + "name": "Meryl", + "outputs": [ + { + "name": "read_db_hist", + "type": "tabular" + } + ], + "position": { + "left": 884.453149536746, + "top": 76.92187131948805 + }, + "post_job_actions": { + "HideDatasetActionread_db_hist": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "read_db_hist" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/meryl/meryl/1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "29dabd8db6f2", + "name": "meryl", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"operation_type\": {\"command_type\": \"histogram-kmers\", \"__current_case__\": 4, \"input_meryldb_02\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3+galaxy6", + "type": "tool", + "uuid": "10eb771d-1437-4602-91b7-e7e6d806dc2e", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/genomescope/genomescope/2.0+galaxy1", + "errors": null, + "id": 6, + "input_connections": { + "input": { + "id": 5, + "output_name": "read_db_hist" + }, + "kmer_length": { + "id": 1, + "output_name": "output" + }, + "ploidy": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "GenomeScope", + "outputs": [ + { + "name": "linear_plot", + "type": "png" + }, + { + "name": "log_plot", + "type": "png" + }, + { + "name": "transformed_linear_plot", + "type": "png" + }, + { + "name": "transformed_log_plot", + "type": "png" + }, + { + "name": "model", + "type": "txt" + }, + { + "name": "summary", + "type": "txt" + }, + { + "name": "model_params", + "type": "tabular" + } + ], + "position": { + "left": 1172.0166187911489, + "top": 96.88919830322266 + }, + "post_job_actions": { + "TagDatasetActionlinear_plot": { + "action_arguments": { + "tags": "genomescope_linear,Linear Plot" + }, + "action_type": "TagDatasetAction", + "output_name": "linear_plot" + }, + "TagDatasetActionlog_plot": { + "action_arguments": { + "tags": "genomescope_log,Log Plot" + }, + "action_type": "TagDatasetAction", + "output_name": "log_plot" + }, + "TagDatasetActionmodel": { + "action_arguments": { + "tags": "genomescope_model" + }, + "action_type": "TagDatasetAction", + "output_name": "model" + }, + "TagDatasetActionmodel_params": { + "action_arguments": { + "tags": "genomescope_params,GenomeScope Parameters" + }, + "action_type": "TagDatasetAction", + "output_name": "model_params" + }, + "TagDatasetActionsummary": { + "action_arguments": { + "tags": "genomescope_summ,GenomeScope Summary" + }, + "action_type": "TagDatasetAction", + "output_name": "summary" + }, + "TagDatasetActiontransformed_linear_plot": { + "action_arguments": { + "tags": "genomescope_tr_linear,Transformed Linear Plot" + }, + "action_type": "TagDatasetAction", + "output_name": "transformed_linear_plot" + }, + "TagDatasetActiontransformed_log_plot": { + "action_arguments": { + "tags": "genomescope_tr_log,Transformed Log Plot" + }, + "action_type": "TagDatasetAction", + "output_name": "transformed_log_plot" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/genomescope/genomescope/2.0+galaxy1", + "tool_shed_repository": { + "changeset_revision": "3169a38c2656", + "name": "genomescope", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advanced_options\": {\"topology\": null, \"initial_repetitiveness\": null, \"initial_heterozygosities\": \"\", \"transform_exp\": null, \"testing\": true, \"true_params\": \"\", \"trace_flag\": false, \"num_rounds\": null}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"kmer_length\": {\"__class__\": \"ConnectedValue\"}, \"lambda\": null, \"max_kmercov\": null, \"output_options\": {\"output_files\": [\"model_output\", \"summary_output\"], \"no_unique_sequence\": false}, \"ploidy\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0+galaxy1", + "type": "tool", + "uuid": "955de351-ef19-42dc-89d7-ca213994515a", + "when": null, + "workflow_outputs": [ + { + "label": "GenomeScope Model Parameters", + "output_name": "model_params", + "uuid": "cb88b945-413c-4e2d-81a9-dd838df902ff" + }, + { + "label": "GenomeScope log plot", + "output_name": "log_plot", + "uuid": "988e2189-d5f2-4e9e-8fc2-4434e68e8501" + }, + { + "label": "GenomeScope linear plot", + "output_name": "linear_plot", + "uuid": "57230be4-36d5-4307-b4b0-b8a73f6800ce" + }, + { + "label": "GenomeScope transformed linear plot", + "output_name": "transformed_linear_plot", + "uuid": "48e2c4c5-8658-44e6-8981-673a2f1f719e" + }, + { + "label": "GenomeScope transformed log plot", + "output_name": "transformed_log_plot", + "uuid": "ea87bd08-a6d9-4c9e-9497-8bfb1725da04" + }, + { + "label": "GenomeScope summary", + "output_name": "summary", + "uuid": "b74004e1-4f4b-4f43-a9f0-2a7a0a70ca1d" + } + ] + } + }, + "tags": [ + "Reviewed", + "VGP" + ], + "uuid": "3553367b-7f97-41e7-aa93-5856b21770df", + "version": 4 +} \ No newline at end of file diff --git a/topics/assembly/tutorials/vgp_workflow_training/workflows/wf4-assembly-Hifi-HiC-phasing.ga b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf4-assembly-Hifi-HiC-phasing.ga new file mode 100644 index 00000000000000..5bd6abc7cf0a5a --- /dev/null +++ b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf4-assembly-Hifi-HiC-phasing.ga @@ -0,0 +1,3311 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "", + "creator": [ + { + "class": "Organization", + "name": "Galaxy" + }, + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "CC-BY-4.0", + "release": "0.1", + "name": "Assembly-Hifi-HiC-phasing-VGP4", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Pacbio Reads Collection" + } + ], + "label": "Pacbio Reads Collection", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 601.6407359730115 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "f7ef62fa-eb54-4489-b444-b6be262a45c0", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "HiC forward reads" + } + ], + "label": "HiC forward reads", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 360.5990149758079, + "top": 821.284901012074 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "d5d37559-d0fd-4d56-bb2f-a89335984a73", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "HiC reverse reads" + } + ], + "label": "HiC reverse reads", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 627.265722101385, + "top": 928.5504890210702 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "94594456-f087-4983-9b0e-014e36084354", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Genomescope Model Parameters" + } + ], + "label": "Genomescope Model Parameters", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 368.9063158902255, + "top": 1208.8194876006157 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "0735f7ce-74e8-4ae0-8142-e6d2fd89c89e", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Genomescope Summary" + } + ], + "label": "Genomescope Summary", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 377.2136225844875, + "top": 1460.503688003078 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "1844cbb3-ba5f-4997-a3cd-ce70f4570a99", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Meryl Database" + } + ], + "label": "Meryl Database", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 1730.5817343971949, + "top": 419.62677926728225 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "fcb0f86e-455a-4a6e-9c86-d8994caf0493", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "Defaults to 37 if not specified. For genomes much larger than human, applying -f38 or even -f39 is preferred to save memory on k-mer counting.", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "Defaults to 37 if not specified. For genomes much larger than human, applying -f38 or even -f39 is preferred to save memory on k-mer counting.", + "name": "Bits for bloom filter" + } + ], + "label": "Bits for bloom filter", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 906.03125, + "top": 1704.0625 + }, + "tool_id": null, + "tool_state": "{\"default\": 37, \"parameter_type\": \"integer\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "b949921b-95a3-4d43-81b2-4006a4909e4b", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "105bb189-a2d4-4cfc-8cb8-39ab70af0277" + } + ] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "SAK input file" + } + ], + "label": "SAK input file", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 1785.3040059407554, + "top": 1450.859578450521 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "557a2e2b-008c-4566-836a-6509950aa85b", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "2a6cc6ed-3248-4048-9208-a683e43f1c0f" + } + ] + }, + "8": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name for Haplotype 1" + } + ], + "label": "Name for Haplotype 1", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 3629.8615195534453, + "top": 1523.559107924953 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Hap1\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "41d1bb31-75f9-4034-abad-96aed4916b45", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "2eef5014-6358-446d-9d97-4a9b43f83e75" + } + ] + }, + "9": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name for Haplotype 2" + } + ], + "label": "Name for Haplotype 2", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 3641.8580719918923, + "top": 1674.3751294685135 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Hap2\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6d5afa06-c3e8-4eb7-8819-8cfe8300c462", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "5f6be88c-dc8a-40ce-8865-c36f26d826d7" + } + ] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "errors": null, + "id": 10, + "input_connections": { + "library|input_1": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Cutadapt", + "outputs": [ + { + "name": "out1", + "type": "fastqsanger" + }, + { + "name": "report", + "type": "txt" + } + ], + "position": { + "left": 476.8230091441762, + "top": 589.340302438447 + }, + "post_job_actions": { + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "Cutadapt on #{library.input_1 }" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "TagDatasetActionout1": { + "action_arguments": { + "tags": "trimmed_hifi" + }, + "action_type": "TagDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1", + "tool_shed_repository": { + "changeset_revision": "135b80fb1ac2", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"adapter_options\": {\"action\": \"trim\", \"internal\": \"\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"35\", \"match_read_wildcards\": \" \", \"revcomp\": true}, \"filter_options\": {\"discard_trimmed\": true, \"discard_untrimmed\": false, \"minimum_length\": null, \"maximum_length\": null, \"length_R2_options\": {\"length_R2_status\": \"False\", \"__current_case__\": 1}, \"max_n\": null, \"pair_filter\": \"any\", \"max_expected_errors\": null, \"discard_cassava\": false}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"anywhere_adapter_source\": {\"anywhere_adapter_source_list\": \"user\", \"__current_case__\": 0, \"anywhere_adapter_name\": \"\", \"anywhere_adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}], \"cut\": \"0\"}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"quality_cutoff\": \"0\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"strip_suffix\": \"\", \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"length_tag\": \"\", \"rename\": \"\", \"zero_cap\": false}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "4.0+galaxy1", + "type": "tool", + "uuid": "64ce3a66-9497-4937-a1b6-7f72814f1fe1", + "when": null, + "workflow_outputs": [ + { + "label": "Cutadapt on input dataset(s): Read 1 Output", + "output_name": "out1", + "uuid": "24af0265-1dce-43a5-9fd2-51b414f0c1ea" + } + ] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 11, + "input_connections": { + "input": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 623.1337807395242, + "top": 1208.8194876006157 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"c3*2\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "bfa738cb-d9c1-4b3c-a89b-71135d65a3b6", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", + "errors": null, + "id": 12, + "input_connections": { + "infile": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Search in textfiles", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 616.7448795203007, + "top": 1458.837058327415 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/1.1.1", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-G\", \"url_paste\": \"Haploid\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "72b7138a-e0d4-4922-9895-c6cbacddbb90", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", + "errors": null, + "id": 13, + "input_connections": { + "results_0|software_cond|input": { + "id": 10, + "output_name": "report" + } + }, + "inputs": [], + "label": null, + "name": "MultiQC", + "outputs": [ + { + "name": "stats", + "type": "input" + }, + { + "name": "html_report", + "type": "html" + } + ], + "position": { + "left": 1017.3959674257222, + "top": 787.7344304865057 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1", + "tool_shed_repository": { + "changeset_revision": "abfd8a6544d7", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"cutadapt\", \"__current_case__\": 5, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"saveLog\": false, \"title\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.11+galaxy1", + "type": "tool", + "uuid": "c60d4342-a7fb-4dd1-8f5f-206fa7e423b8", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 14, + "input_connections": { + "input": { + "id": 11, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 875.2518393776635, + "top": 1212.2222900390627 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c7\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "ca6bbaa5-0c32-4504-94ba-6f8644e6f655", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/1.1.2", + "errors": null, + "id": 15, + "input_connections": { + "infile": { + "id": 12, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Replace Text", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 872.2483548251066, + "top": 1459.5748438979645 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"infile\": {\"__class__\": \"ConnectedValue\"}, \"replacements\": [{\"__index__\": 0, \"find_pattern\": \"bp\", \"replace_pattern\": \"\"}, {\"__index__\": 1, \"find_pattern\": \",\", \"replace_pattern\": \"\"}, {\"__index__\": 2, \"find_pattern\": \"([a-z])\\\\s+([A-Z])\", \"replace_pattern\": \"\\\\1_\\\\2\"}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "565beb6a-79f6-4ceb-80f3-46939db4d9c9", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 16, + "input_connections": { + "input1": { + "id": 14, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Estimated homozygous read coverage", + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1109.154712670362, + "top": 1218.6660569445944 + }, + "post_job_actions": { + "RenameDatasetActioninteger_param": { + "action_arguments": { + "newname": "Estimated homozygous read coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e1360db3-bf77-402c-a450-36d74adbddc6", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "Convert characters1", + "errors": null, + "id": 17, + "input_connections": { + "input": { + "id": 15, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Convert", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1116.4237051299124, + "top": 1467.821248372396 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Convert characters1", + "tool_state": "{\"condense\": true, \"convert_from\": \"s\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"strip\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "e901d941-c0fe-4915-b9e7-1a7e69596bd2", + "when": null, + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy4", + "errors": null, + "id": 18, + "input_connections": { + "assembly_options|hom_cov": { + "id": 16, + "output_name": "integer_param" + }, + "filter_bits": { + "id": 6, + "output_name": "output" + }, + "hic_partition|h1": { + "id": 1, + "output_name": "output" + }, + "hic_partition|h2": { + "id": 2, + "output_name": "output" + }, + "mode|reads": { + "id": 10, + "output_name": "out1" + } + }, + "inputs": [], + "label": null, + "name": "Hifiasm", + "outputs": [ + { + "name": "noseq files", + "type": "input" + }, + { + "name": "hic_pcontig_graph", + "type": "gfa1" + }, + { + "name": "hic_acontig_graph", + "type": "gfa1" + }, + { + "name": "hic_balanced_contig_hap1_graph", + "type": "gfa1" + }, + { + "name": "hic_balanced_contig_hap2_graph", + "type": "gfa1" + }, + { + "name": "hic_raw_initig", + "type": "gfa1" + }, + { + "name": "log_file", + "type": "txt" + } + ], + "position": { + "left": 1650.198023834119, + "top": 729.0981977671058 + }, + "post_job_actions": { + "HideDatasetActionhic_acontig_graph": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "hic_acontig_graph" + }, + "HideDatasetActionhic_pcontig_graph": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "hic_pcontig_graph" + }, + "TagDatasetActionhic_balanced_contig_hap1_graph": { + "action_arguments": { + "tags": "hifiasm_hic_hap1_gfa, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "hic_balanced_contig_hap1_graph" + }, + "TagDatasetActionhic_balanced_contig_hap2_graph": { + "action_arguments": { + "tags": "hifiasm_hic_hap2_gfa, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "hic_balanced_contig_hap2_graph" + }, + "TagDatasetActionhic_raw_initig": { + "action_arguments": { + "tags": "hifiasm_hic_unitig_gfa" + }, + "action_type": "TagDatasetAction", + "output_name": "hic_raw_initig" + }, + "TagDatasetActionlog_file": { + "action_arguments": { + "tags": "hifiasm_hic_log" + }, + "action_type": "TagDatasetAction", + "output_name": "log_file" + }, + "TagDatasetActionnoseq files": { + "action_arguments": { + "tags": "noseq_hifiasm" + }, + "action_type": "TagDatasetAction", + "output_name": "noseq files" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.16.1+galaxy4", + "tool_shed_repository": { + "changeset_revision": "5f625c63b8bc", + "name": "hifiasm", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advanced_options\": {\"advanced_selector\": \"blank\", \"__current_case__\": 0}, \"assembly_options\": {\"assembly_selector\": \"set\", \"__current_case__\": 1, \"cleaning_rounds\": \"4\", \"adapter_length\": \"0\", \"pop_contigs\": \"10000000\", \"pop_unitigs\": \"100000\", \"remove_tips\": \"3\", \"max_overlap\": \"0.8\", \"min_overlap\": \"0.2\", \"disable_post_join\": false, \"ignore_error_corrected\": false, \"hom_cov\": {\"__class__\": \"ConnectedValue\"}}, \"filter_bits\": {\"__class__\": \"ConnectedValue\"}, \"hic_partition\": {\"hic_partition_selector\": \"set\", \"__current_case__\": 1, \"h1\": {\"__class__\": \"ConnectedValue\"}, \"h2\": {\"__class__\": \"ConnectedValue\"}, \"seed\": null, \"n_weight\": null, \"n_perturb\": null, \"f_perturb\": null, \"l_msjoin\": \"500000\"}, \"log_out\": true, \"mode\": {\"mode_selector\": \"standard\", \"__current_case__\": 0, \"reads\": {\"__class__\": \"ConnectedValue\"}}, \"purge_options\": {\"purge_selector\": \"blank\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.16.1+galaxy4", + "type": "tool", + "uuid": "0178b5a1-d244-43bc-85e4-e83d1360a94e", + "when": null, + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 19, + "input_connections": { + "input": { + "id": 17, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1364.3925291119203, + "top": 1599.019091057055 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "34ffee0e-99e4-4c04-ad64-1d3a50b39102", + "when": null, + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2078.7762035023084, + "top": 3.9236357717803685 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "usable hap1 gfa" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hic_hap1_gfa" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"RuntimeValue\"}, \"output_condition\": {\"out_format\": \"gfa\", \"__current_case__\": 4, \"terminal_overlaps_condition\": {\"terminal_overlaps_select\": \"no\", \"__current_case__\": 0}}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "2bf6f1be-461a-45e1-aa5f-0af394563a23", + "when": null, + "workflow_outputs": [ + { + "label": "usable hap1 gfa", + "output_name": "output", + "uuid": "853d982b-69e8-436f-a791-4f7875034109" + } + ] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 21, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + }, + "mode_condition|swiss_army_knife": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2233.6199904933123, + "top": 369.32299064867425 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"fasta\", \"__current_case__\": 0, \"line_length\": null}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "cd65bf95-931d-4514-8851-6652198c7ab7", + "when": null, + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 22, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + }, + "mode_condition|swiss_army_knife": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2240.694704922763, + "top": 636.0591079249527 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"fasta\", \"__current_case__\": 0, \"line_length\": null}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "596ea56e-3c73-402a-b1ae-e2be1bb91227", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 23, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2414.062661835642, + "top": 0 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "usable hap2 gfa" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hic_hap2_gfa" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"RuntimeValue\"}, \"output_condition\": {\"out_format\": \"gfa\", \"__current_case__\": 4, \"terminal_overlaps_condition\": {\"terminal_overlaps_select\": \"no\", \"__current_case__\": 0}}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "4d4a30a0-d2e9-4814-afc2-74e4194ebdf5", + "when": null, + "workflow_outputs": [ + { + "label": "usable hap2 gfa", + "output_name": "output", + "uuid": "03228d5f-a300-4321-b715-ffc466c21246" + } + ] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bandage/bandage_image/2022.09+galaxy4", + "errors": null, + "id": 24, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_raw_initig" + } + }, + "inputs": [], + "label": "Raw Unitig Image", + "name": "Bandage Image", + "outputs": [ + { + "name": "outfile", + "type": "jpg" + } + ], + "position": { + "left": 2310.4689858176494, + "top": 961.6668701171877 + }, + "post_job_actions": { + "TagDatasetActionoutfile": { + "action_arguments": { + "tags": "utg_png" + }, + "action_type": "TagDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bandage/bandage_image/2022.09+galaxy4", + "tool_shed_repository": { + "changeset_revision": "ddddce450736", + "name": "bandage", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fontsize\": null, \"height\": \"2000\", \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"lengths\": false, \"names\": false, \"nodewidth\": \"25.0\", \"output_format\": \"png\", \"width\": null, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2022.09+galaxy4", + "type": "tool", + "uuid": "c023af81-3c79-43f9-96df-8d982b19e4ed", + "when": null, + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 25, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2835.987005198547, + "top": 1467.2530248543883 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Contig sizes for hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_contigs_hap1, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"size\", \"__current_case__\": 0, \"out_size\": \"c\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "ed95e95b-68f3-47f4-ac03-eb4fb01d3020", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 26, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2836.927541097006, + "top": 1803.8369843454075 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Contig sizes for hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_contigs_hap2, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"size\", \"__current_case__\": 0, \"out_size\": \"c\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "723d5c3e-c0ec-4085-bccd-29d5d97ce3f8", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 27, + "input_connections": { + "input1": { + "id": 19, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Estimated genome size", + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1645.6251433401399, + "top": 1621.8578916607485 + }, + "post_job_actions": { + "RenameDatasetActioninteger_param": { + "action_arguments": { + "newname": "Estimated Genome size" + }, + "action_type": "RenameDatasetAction", + "output_name": "integer_param" + }, + "TagDatasetActioninteger_param": { + "action_arguments": { + "tags": "estimated_genome_size" + }, + "action_type": "TagDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "e0531bfd-5007-4e75-8f71-2f06c123831b", + "when": null, + "workflow_outputs": [ + { + "label": "Estimated Genome size", + "output_name": "integer_param", + "uuid": "a6854349-56a1-4ebd-845b-237f3600a0a6" + } + ] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "errors": null, + "id": 28, + "input_connections": { + "infile": { + "id": 21, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Text transformation", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 2487.5695199677443, + "top": 342.17880711411 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Hifiasm HiC hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hifiasm_hic_hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"s/_path//g\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "82af5c81-e733-4e57-b931-8234ab6c8056", + "when": null, + "workflow_outputs": [ + { + "label": "Hifiasm HiC hap1", + "output_name": "output", + "uuid": "08ba11ee-88b3-41f3-9d0a-93be5308820d" + } + ] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "errors": null, + "id": 29, + "input_connections": { + "infile": { + "id": 22, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Text transformation", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 2490.9810152920813, + "top": 512.5868363813922 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Hifiasm HiC hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "hifiasm_hic_hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/1.1.1", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"s/_path//g\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "d8a10e0c-5a9c-4c4f-910a-8a94cdcba7f0", + "when": null, + "workflow_outputs": [ + { + "label": "Hifiasm HiC hap2", + "output_name": "output", + "uuid": "550d450c-009c-4e14-bbc5-a9ab7e3e55ab" + } + ] + }, + "30": { + "annotation": "", + "id": 30, + "input_connections": { + "gfa_stats": { + "id": 25, + "input_subworkflow_step_id": 0, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_data_prep", + "outputs": [], + "position": { + "left": 3927.4223327636723, + "top": 833.7675152402937 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "gfastats_data_prep", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "gfa_stats" + } + ], + "label": "gfa_stats", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 189.90056800842285 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "7f250de3-98cc-448b-b573-6b8a85c71352", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "sort1", + "errors": null, + "id": 1, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 302.6136245727539, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "sort1", + "tool_state": "{\"column\": \"2\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"DESC\", \"style\": \"num\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "55d86a03-5706-4070-b468-5e8407d3c871", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 1, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 292.1306838989258, + "top": 235.1562442779541 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{total += $2; $3 = total}1\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "69c7b2e7-5c82-49ec-8301-737e5ec1739b", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "in_file": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 595.0994338989258, + "top": 116.0227222442627 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "746e8e4bf929", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0+galaxy2", + "type": "tool", + "uuid": "1cdafa6b-ccdb-4b90-8dc6-ea1f92425715", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "addValue", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 479.0482864379883, + "top": 456.17896461486816 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "addValue", + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "9a266291-d20c-42ff-b55f-bb334bd520d8", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 693.4658889770508, + "top": 299.4318027496338 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "81bf512c-89b3-4b18-b7e9-36ae448a828f", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "components_1|param_type|component_value": { + "id": 5, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 885.0994338989258, + "top": 493.36646461486816 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c3/\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "bda1a1ff-ab78-4338-a511-d24f851ec102", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "ops|expressions_0|cond": { + "id": 6, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1115.0993728637695, + "top": 735.5255222320557 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "gfastats data for plotting" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "c93568ca-103f-4d8e-af88-d6de721e30cd", + "when": null, + "workflow_outputs": [ + { + "label": "gfastats data for plotting", + "output_name": "out_file1", + "uuid": "68af2c3b-8f48-4bde-9dd1-a78151d6de1a" + } + ] + } + }, + "tags": "", + "uuid": "7bd25948-5c58-440c-af93-0d71235a782a" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "7df6c0b4-4fdc-43fc-bb3e-cc1d43c5ad0b", + "when": null, + "workflow_outputs": [] + }, + "31": { + "annotation": "", + "id": 31, + "input_connections": { + "gfa_stats": { + "id": 26, + "input_subworkflow_step_id": 0, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_data_prep", + "outputs": [], + "position": { + "left": 3922.431136622574, + "top": 1057.8214703184187 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "gfastats_data_prep", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "gfa_stats" + } + ], + "label": "gfa_stats", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 189.90056800842285 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "7f250de3-98cc-448b-b573-6b8a85c71352", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "sort1", + "errors": null, + "id": 1, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 302.6136245727539, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "sort1", + "tool_state": "{\"column\": \"2\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"DESC\", \"style\": \"num\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "55d86a03-5706-4070-b468-5e8407d3c871", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 1, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 292.1306838989258, + "top": 235.1562442779541 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{total += $2; $3 = total}1\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "69c7b2e7-5c82-49ec-8301-737e5ec1739b", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "in_file": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 595.0994338989258, + "top": 116.0227222442627 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "746e8e4bf929", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0+galaxy2", + "type": "tool", + "uuid": "1cdafa6b-ccdb-4b90-8dc6-ea1f92425715", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "addValue", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 479.0482864379883, + "top": 456.17896461486816 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "addValue", + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "9a266291-d20c-42ff-b55f-bb334bd520d8", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 693.4658889770508, + "top": 299.4318027496338 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "81bf512c-89b3-4b18-b7e9-36ae448a828f", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "components_1|param_type|component_value": { + "id": 5, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 885.0994338989258, + "top": 493.36646461486816 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c3/\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "bda1a1ff-ab78-4338-a511-d24f851ec102", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "ops|expressions_0|cond": { + "id": 6, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1115.0993728637695, + "top": 735.5255222320557 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "gfastats data for plotting" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "c93568ca-103f-4d8e-af88-d6de721e30cd", + "when": null, + "workflow_outputs": [ + { + "label": "gfastats data for plotting", + "output_name": "out_file1", + "uuid": "68af2c3b-8f48-4bde-9dd1-a78151d6de1a" + } + ] + } + }, + "tags": "", + "uuid": "7bd25948-5c58-440c-af93-0d71235a782a" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "9d2e48a6-d050-49ee-af0a-31ca952c4535", + "when": null, + "workflow_outputs": [] + }, + "32": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 32, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap1_graph" + }, + "mode_condition|statistics_condition|expected_genomesize": { + "id": 27, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2827.101065895775, + "top": 1285.946470318419 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Assembly stats for hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_asm_hap1, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"assembly\", \"__current_case__\": 2, \"expected_genomesize\": {\"__class__\": \"ConnectedValue\"}}, \"locale\": true, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "fe43bf41-0e43-482e-99bb-7a855d4bcb2f", + "when": null, + "workflow_outputs": [] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 33, + "input_connections": { + "input_file": { + "id": 18, + "output_name": "hic_balanced_contig_hap2_graph" + }, + "mode_condition|statistics_condition|expected_genomesize": { + "id": 27, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2835.8424100008883, + "top": 1631.1285770300665 + }, + "post_job_actions": { + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Assembly stats for hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_asm_hap2, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"assembly\", \"__current_case__\": 2, \"expected_genomesize\": {\"__class__\": \"ConnectedValue\"}}, \"locale\": true, \"tabular\": true, \"discover_paths\": true}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "001f8c0e-234a-4406-9d8b-a26b8e878c56", + "when": null, + "workflow_outputs": [] + }, + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "errors": null, + "id": 34, + "input_connections": { + "input": { + "id": 28, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Busco", + "outputs": [ + { + "name": "busco_sum", + "type": "txt" + }, + { + "name": "busco_table", + "type": "tabular" + }, + { + "name": "busco_missing", + "type": "tabular" + }, + { + "name": "summary_image", + "type": "png" + } + ], + "position": { + "left": 3074.6484375, + "top": 65.95703125 + }, + "post_job_actions": { + "TagDatasetActionbusco_missing": { + "action_arguments": { + "tags": "busco_hap1_missing, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_missing" + }, + "TagDatasetActionbusco_sum": { + "action_arguments": { + "tags": "busco_hap1_summ, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_sum" + }, + "TagDatasetActionbusco_table": { + "action_arguments": { + "tags": "busco_hap1_full, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_table" + }, + "TagDatasetActionsummary_image": { + "action_arguments": { + "tags": "busco_hap1_img, #hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "summary_image" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "41030a6c03b7", + "name": "busco", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.3.2+galaxy0", + "type": "tool", + "uuid": "a4957dee-45cc-4f34-ae2e-e07f93b9fcc4", + "when": null, + "workflow_outputs": [ + { + "label": "Busco Summary Image Hap1", + "output_name": "summary_image", + "uuid": "cfac3083-4c1e-4bb4-91a5-eba5d19f2757" + }, + { + "label": "Busco Summary Hap1", + "output_name": "busco_sum", + "uuid": "bd6443ea-5266-4dfc-8f1e-aded27317da8" + } + ] + }, + "35": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "errors": null, + "id": 35, + "input_connections": { + "mode|assembly_options|assembly_01": { + "id": 28, + "output_name": "output" + }, + "mode|assembly_options|assembly_02": { + "id": 29, + "output_name": "output" + }, + "mode|meryldb_F1": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Merqury", + "outputs": [ + { + "name": "qv_files", + "type": "input" + }, + { + "name": "png_files", + "type": "input" + }, + { + "name": "stats_files", + "type": "input" + }, + { + "name": "log_file", + "type": "txt" + } + ], + "position": { + "left": 2855.921875, + "top": 789.0859375 + }, + "post_job_actions": { + "HideDatasetActionlog_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "log_file" + }, + "TagDatasetActionbed_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_bed, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "bed_files" + }, + "TagDatasetActionpng_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_png, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "png_files" + }, + "TagDatasetActionqv_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_qv, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "qv_files" + }, + "TagDatasetActionsizes_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_sizes, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "sizes_files" + }, + "TagDatasetActionstats_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_stats, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "stats_files" + }, + "TagDatasetActionwig_files": { + "action_arguments": { + "tags": "merqury_hifi_hic_wig, #hic_phased" + }, + "action_type": "TagDatasetAction", + "output_name": "wig_files" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f8113c25bc6b", + "name": "merqury", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"label\": \"output_merqury\", \"mode\": {\"options\": \"default\", \"__current_case__\": 0, \"meryldb_F1\": {\"__class__\": \"ConnectedValue\"}, \"assembly_options\": {\"number_assemblies\": \"two\", \"__current_case__\": 1, \"assembly_01\": {\"__class__\": \"ConnectedValue\"}, \"assembly_02\": {\"__class__\": \"ConnectedValue\"}}}, \"output_add_headers\": true, \"output_selector\": [\"qv\", \"plots\", \"stats\", \"log\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3+galaxy2", + "type": "tool", + "uuid": "9985e575-3113-4c2c-bc2c-78faab3a1291", + "when": null, + "workflow_outputs": [ + { + "label": "Merqury images", + "output_name": "png_files", + "uuid": "4983a97f-9dd1-44d2-a4be-d13e9a651f41" + } + ] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "errors": null, + "id": 36, + "input_connections": { + "input": { + "id": 29, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Busco", + "outputs": [ + { + "name": "busco_sum", + "type": "txt" + }, + { + "name": "busco_table", + "type": "tabular" + }, + { + "name": "busco_missing", + "type": "tabular" + }, + { + "name": "summary_image", + "type": "png" + } + ], + "position": { + "left": 3079.7265625, + "top": 499.28515625 + }, + "post_job_actions": { + "TagDatasetActionbusco_missing": { + "action_arguments": { + "tags": "busco_hap2_missing, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_missing" + }, + "TagDatasetActionbusco_sum": { + "action_arguments": { + "tags": "busco_hap2_summ, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_sum" + }, + "TagDatasetActionbusco_table": { + "action_arguments": { + "tags": "busco_hap2_full, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_table" + }, + "TagDatasetActionsummary_image": { + "action_arguments": { + "tags": "busco_hap2_img, #hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "summary_image" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "41030a6c03b7", + "name": "busco", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": \"vertebrata_odb10\"}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.3.2+galaxy0", + "type": "tool", + "uuid": "08066bc3-0992-4606-844d-16be3c56691a", + "when": null, + "workflow_outputs": [ + { + "label": "Busco Summary Hap2", + "output_name": "busco_sum", + "uuid": "bf7e959c-5252-467e-bb58-2b8cabbd0f3b" + }, + { + "label": "Busco Summary Image Hap2", + "output_name": "summary_image", + "uuid": "84725fc4-3480-44a2-abc0-abc8f54addb1" + } + ] + }, + "37": { + "annotation": "", + "id": 37, + "input_connections": { + "Alternate data": { + "id": 31, + "input_subworkflow_step_id": 1, + "output_name": "gfastats data for plotting" + }, + "Name of alternate assembly": { + "id": 9, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Name of primary assembly": { + "id": 8, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Primary data": { + "id": 30, + "input_subworkflow_step_id": 0, + "output_name": "gfastats data for plotting" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_plot", + "outputs": [], + "position": { + "left": 4346.40625, + "top": 866.4609375 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "creator": [ + { + "class": "Organization", + "name": "Galaxy" + }, + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + } + ], + "format-version": "0.1", + "license": "CC-BY-4.0", + "name": "gfastats_plot", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Primary data" + } + ], + "label": "Primary data", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 0.0 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "a9a972e8-76f3-416f-9148-77203f6df3b8", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Alternate data" + } + ], + "label": "Alternate data", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 6.960205078125, + "top": 143.53692626953125 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "a5ce76b6-ae69-4c5d-b42f-dc211c9b64cc", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of primary assembly" + } + ], + "label": "Name of primary assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 4.55963134765625, + "top": 296.3210144042969 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Primary\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6118c82a-61da-4856-9e25-1f0d93297527", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "894be62c-079d-4209-a098-1858de70948a" + } + ] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of alternate assembly" + } + ], + "label": "Name of alternate assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 7.428955078125, + "top": 440.4403076171875 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Alternate\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "3204b6e0-bd83-4a8d-8ddb-3b0dd89dbd04", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "3d7657f7-0651-43c1-80bb-57c4fa6d3502" + } + ] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "errors": null, + "id": 4, + "input_connections": { + "exp": { + "id": 2, + "output_name": "output" + }, + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1139.7584686279297, + "top": 107.42897033691406 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_shed_repository": { + "changeset_revision": "745871c0b055", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "8bc6adbb-1346-4521-bd69-ffa2738bad07", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "errors": null, + "id": 5, + "input_connections": { + "exp": { + "id": 3, + "output_name": "output" + }, + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1151.7044982910156, + "top": 392.65625 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_shed_repository": { + "changeset_revision": "745871c0b055", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "63c7b63c-5179-4ab3-9682-7d150029446e", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "inputs": { + "id": 4, + "output_name": "out_file1" + }, + "queries_0|inputs2": { + "id": 5, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1441.193115234375, + "top": 216.59091186523438 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", + "tool_shed_repository": { + "changeset_revision": "d698c222f354", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"inputs2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "edbf8363-cf44-4536-b45c-60d54088e0fb", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 6, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1780.3265991210938, + "top": 182.99716186523438 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c8,c5,c6\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "ffa38570-79c9-41e6-9a55-3245d5427fa1", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 8, + "input_connections": { + "input": { + "id": 6, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1781.349365234375, + "top": 387.96875 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c8,c4,c7\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "6567b833-44b5-41e6-885b-d1d17b5d9376", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 9, + "input_connections": { + "input1": { + "id": 7, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], + "label": "Nx Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 2068.1390991210938, + "top": 31.988632202148438 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Nx Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#nx_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"x\", \"xplot\": \"2\", \"ylab\": \"Nx (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "18c6ac70-f4d3-4d68-93f8-c08afafbc6c5", + "when": null, + "workflow_outputs": [ + { + "label": "Nx Plot", + "output_name": "output1", + "uuid": "d1dd55bd-0441-4cfd-baf2-767ef768d01e" + } + ] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 10, + "input_connections": { + "input1": { + "id": 8, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], + "label": "Size Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 2083.3805541992188, + "top": 319.8011169433594 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Size Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#size_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"Scaffold number\", \"xplot\": \"2\", \"ylab\": \"Cumulative Size (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "cce1fe43-55c6-4c1a-a957-ac7af9271c46", + "when": null, + "workflow_outputs": [ + { + "label": "Size Plot", + "output_name": "output1", + "uuid": "c979a10d-de93-4c02-b286-0ec0fca016b9" + } + ] + } + }, + "tags": "", + "uuid": "34d71948-bc67-4261-ad4c-6de491826e89" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "1b8e2d4e-3380-4414-bdb0-b356383c0ee2", + "when": null, + "workflow_outputs": [ + { + "label": "Nx Plot", + "output_name": "Nx Plot", + "uuid": "781f8511-c3fe-4954-afa8-d21c94c996a4" + }, + { + "label": "Size Plot", + "output_name": "Size Plot", + "uuid": "03a0d2a8-c2d5-4ca7-80fe-7d04d1c4894a" + }, + { + "label": null, + "output_name": "2:output", + "uuid": "8614c252-637a-48dc-a751-9a3fea85b376" + }, + { + "label": null, + "output_name": "3:output", + "uuid": "b1b37b5e-092a-4bcb-87ab-f8b74abe1ebb" + } + ] + }, + "38": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 38, + "input_connections": { + "infile": { + "id": 32, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 3176.285044352214, + "top": 1140.6685569069605 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"BEGIN{print \\\"Metric\\\\thap1\\\"}; {print}; \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "e0c8072a-6132-4669-be68-a44981f659da", + "when": null, + "workflow_outputs": [] + }, + "39": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 39, + "input_connections": { + "infile": { + "id": 33, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 3177.439533580434, + "top": 1537.5955292672825 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"BEGIN{print \\\"Metric\\\\thap2\\\"}; {print}; \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "3ae908c6-47d7-40b0-b73e-95f1ed49dd24", + "when": null, + "workflow_outputs": [] + }, + "40": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 40, + "input_connections": { + "input": { + "id": 39, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 3407.691331343218, + "top": 1368.6198841441765 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c2\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1164d973-2ba9-4242-bae1-2a7b6c4678b6", + "when": null, + "workflow_outputs": [] + }, + "41": { + "annotation": "", + "content_id": "Paste1", + "errors": null, + "id": 41, + "input_connections": { + "input1": { + "id": 38, + "output_name": "outfile" + }, + "input2": { + "id": 40, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Paste", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3649.617149584222, + "top": 1140.9336085464017 + }, + "post_job_actions": { + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "gfastats_asm_hap1_hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Paste1", + "tool_state": "{\"delimiter\": \"T\", \"input1\": {\"__class__\": \"ConnectedValue\"}, \"input2\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "bd181af5-44c6-4041-a2f0-e5cb8991b9fb", + "when": null, + "workflow_outputs": [ + { + "label": "Assembly statistics fir Hap1 and Hap2", + "output_name": "out_file1", + "uuid": "e83786b6-dd5e-4c91-8c36-c2d5eecab79d" + } + ] + } + }, + "tags": [ + "VGP", + "Reviewed" + ], + "uuid": "e6c42d60-3c0c-4c40-890a-0f5db9962b30", + "version": 17 +} \ No newline at end of file diff --git a/topics/assembly/tutorials/vgp_workflow_training/workflows/wf6-purge-duplicate-contigs.ga b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf6-purge-duplicate-contigs.ga new file mode 100644 index 00000000000000..7886c2a67cb4ae --- /dev/null +++ b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf6-purge-duplicate-contigs.ga @@ -0,0 +1,3428 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "Purge contigs marked as duplicates by purge_dups (could be haplotypic duplication or overlap duplication). This workflow is the 6th workflow of the VGP pipeline. It is meant to be run after one of the contigging steps (Workflow 3, 4, or 5)", + "creator": [ + { + "class": "Organization", + "name": "Galaxy" + }, + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + } + ], + "format-version": "0.1", + "license": "CC-BY-4.0", + "release":"0.1.1", + "name": "Purge duplicate contigs (WF6) ", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Pacbio Reads Collection - Trimmed" + } + ], + "label": "Pacbio Reads Collection - Trimmed", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 6.078125, + "top": 0 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\", \"collection_type\": \"list\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "0df002ab-91cf-4767-a348-9ce31f439a01", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hifiasm Primary assembly" + } + ], + "label": "Hifiasm Primary assembly", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 111.5 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "158c873a-b3bc-4135-95d4-d435a4849786", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hifiasm Alternate assembly" + } + ], + "label": "Hifiasm Alternate assembly", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 14.1624755859375, + "top": 210.72500610351562 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "681334cb-47f1-49cb-9f86-612e17655419", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Meryl Database" + } + ], + "label": "Meryl Database", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 14.171875, + "top": 315.234375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "0c3b5f68-3534-4d76-b291-e844707606ec", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Genomescope model parameters" + } + ], + "label": "Genomescope model parameters", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 16.078125, + "top": 428.125 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"GenomeScopeParameters\"}", + "tool_version": null, + "type": "data_input", + "uuid": "5c8af4f2-5764-49a6-89fa-dd8730b11828", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated genome size - Parameter File" + } + ], + "label": "Estimated genome size - Parameter File", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 6.546875, + "top": 579.9375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"estimated_genome_size\"}", + "tool_version": null, + "type": "data_input", + "uuid": "9cc9d8e4-a917-4258-a9fc-74de593c42de", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Busco Lineage" + } + ], + "label": "Busco Lineage", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 1202.3213024806632, + "top": 1405.449719429178 + }, + "tool_id": null, + "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "a489e27a-9a41-41e2-ab57-db2e855b1018", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "SAK input file" + } + ], + "label": "SAK input file", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 2653.1960436976224, + "top": 1846.0753303322142 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "f53ab5b0-6b4d-43ea-8876-a1e2476fc7c6", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of primary assembly" + } + ], + "label": "Name of primary assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 4422.09375, + "top": 201.9375 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Primary\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "2952f3e6-cc98-4cbe-ac46-32adb482ff3d", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of alternate assembly" + } + ], + "label": "Name of alternate assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 4426.75, + "top": 321.09375 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Alternate\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "fd024c72-fe6c-4cd9-ac28-c8e86eaafc4f", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "errors": null, + "id": 10, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 0, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 1124.296875, + "top": 44.96875 + }, + "post_job_actions": { + "ChangeDatatypeActionalignment_output": { + "action_arguments": { + "newtype": "paf" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "alignment_output" + }, + "HideDatasetActionalignment_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "tool_shed_repository": { + "changeset_revision": "11a0d50a54e6", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"asm5\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.24+galaxy0", + "type": "tool", + "uuid": "37c8f9b6-ec2e-43f7-9055-5f4f92436903", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "function_select|input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "split_fasta", + "type": "fasta" + } + ], + "position": { + "left": 1420.9375, + "top": 1257.796875 + }, + "post_job_actions": { + "HideDatasetActionsplit_fasta": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "split_fasta" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"split_fa\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "bc4c132e-b355-4996-aa7e-11423e4253c5", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 12, + "input_connections": { + "input": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 911.140625, + "top": 946.390625 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"1.5*c3\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"3*c7\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "104983c1-2416-47ce-a805-9932cc0300a3", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 13, + "input_connections": { + "input1": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "Estimated genome size", + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 4168.796875, + "top": 1606.984375 + }, + "post_job_actions": { + "RenameDatasetActioninteger_param": { + "action_arguments": { + "newname": "Estimated Genome size" + }, + "action_type": "RenameDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "66e97598-4765-4430-afd3-df587f986c81", + "when": null, + "workflow_outputs": [ + { + "label": "Estimated Genome Size", + "output_name": "integer_param", + "uuid": "a6d1a01f-ee44-4faa-a8a1-0f20fde412e8" + } + ] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "errors": null, + "id": 14, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 11, + "output_name": "split_fasta" + }, + "reference_source|ref_file": { + "id": 11, + "output_name": "split_fasta" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 1715.7968595217624, + "top": 1173.0859238591086 + }, + "post_job_actions": { + "ChangeDatatypeActionalignment_output": { + "action_arguments": { + "newtype": "paf" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "tool_shed_repository": { + "changeset_revision": "11a0d50a54e6", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": \"1\", \"B\": \"19\", \"O\": \"39\", \"O2\": \"81\", \"E\": \"3\", \"E2\": \"1\", \"z\": \"200\", \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"self-homology\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": \"100\", \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": \"40\", \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.24+galaxy0", + "type": "tool", + "uuid": "9bceadad-bf25-46f7-8d3f-d9ab18dde578", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 15, + "input_connections": { + "input": { + "id": 12, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1391.40625, + "top": 793.65625 + }, + "post_job_actions": {}, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c8\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "6fc4a474-db85-4503-8879-4698250564ed", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 16, + "input_connections": { + "input": { + "id": 12, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1386.34375, + "top": 1043.734375 + }, + "post_job_actions": {}, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c7\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "294539f6-ccc6-4bc3-baec-15a668a80899", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 17, + "input_connections": { + "input1": { + "id": 15, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1735.796875, + "top": 560.84375 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + }, + "TagDatasetActioncalcuts_cutoff": { + "action_arguments": { + "tags": "p1_calcuts_cutoffs" + }, + "action_type": "TagDatasetAction", + "output_name": "calcuts_cutoff" + }, + "TagDatasetActionhist": { + "action_arguments": { + "tags": "p1_calcuts_hist" + }, + "action_type": "TagDatasetAction", + "output_name": "hist" + }, + "TagDatasetActionpbcstat_cov": { + "action_arguments": { + "tags": "p1_calcuts_basecov" + }, + "action_type": "TagDatasetAction", + "output_name": "pbcstat_cov" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "f88e694e-edcf-47b2-905d-b9d5be3886eb", + "when": null, + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 18, + "input_connections": { + "input1": { + "id": 16, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 1671.109375, + "top": 878.90625 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "56cf2739-93df-4d25-baf5-1d1d8ce4aa0f", + "when": null, + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 19, + "input_connections": { + "function_select|input": { + "id": 10, + "output_name": "alignment_output" + }, + "function_select|section_calcuts|transition": { + "id": 18, + "output_name": "integer_param" + }, + "function_select|section_calcuts|upper_depth": { + "id": 17, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "stat_file", + "type": "tabular" + }, + { + "name": "pbcstat_cov", + "type": "tabular" + }, + { + "name": "pbcstat_wig", + "type": "wig" + }, + { + "name": "hist", + "type": "png" + }, + { + "name": "calcuts_log", + "type": "txt" + }, + { + "name": "calcuts_cutoff", + "type": "tabular" + } + ], + "position": { + "left": 2290.36328125, + "top": 327.0234375 + }, + "post_job_actions": { + "TagDatasetActioncalcuts_cutoff": { + "action_arguments": { + "tags": "p1_calcuts_cutoffs, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "calcuts_cutoff" + }, + "TagDatasetActioncalcuts_log": { + "action_arguments": { + "tags": "p1_calcuts_log, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "calcuts_log" + }, + "TagDatasetActionhist": { + "action_arguments": { + "tags": "p1_calcuts_hist, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "hist" + }, + "TagDatasetActionpbcstat_cov": { + "action_arguments": { + "tags": "p1_calcuts_basecov, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "pbcstat_cov" + }, + "TagDatasetActionpbcstat_wig": { + "action_arguments": { + "tags": "p1_calcuts_basecov_wig, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "pbcstat_wig" + }, + "TagDatasetActionstat_file": { + "action_arguments": { + "tags": "p1_calcuts_depths, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "stat_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"pbcstat\", \"__current_case__\": 2, \"input\": {\"__class__\": \"ConnectedValue\"}, \"pbcstat_options\": {\"max_cov\": \"500\", \"min_map_ratio\": \"0.0\", \"min_map_qual\": null, \"flank\": \"0\", \"primary_alignments\": true}, \"section_calcuts\": {\"min_depth\": \"0.1\", \"low_depth\": \"1\", \"transition\": {\"__class__\": \"ConnectedValue\"}, \"upper_depth\": {\"__class__\": \"ConnectedValue\"}, \"ploidy\": \"-d 0\"}, \"section_hist\": {\"ymin\": null, \"ymax\": null, \"xmin\": null, \"xmax\": null, \"title\": \"Read depth histogram plot\"}, \"output_options\": [\"pbcstat_coverage\", \"pbcstat_wig\", \"depth_stats\", \"histogram\", \"calcuts_cutoff\", \"calcuts_log\"]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "97ce37f6-db2d-483c-abab-813827929e9b", + "when": null, + "workflow_outputs": [ + { + "label": "Read Coverage and cutoffs calculation on primary assembly : Histogram plot", + "output_name": "hist", + "uuid": "2e045d9d-99e4-457f-9cee-691616ed6590" + }, + { + "label": "Cutoffs for primary assembly", + "output_name": "calcuts_cutoff", + "uuid": "d2c6d9bd-e28f-4ff1-ac7b-f9068e49a582" + } + ] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "function_select|coverage": { + "id": 19, + "output_name": "pbcstat_cov" + }, + "function_select|cutoffs": { + "id": 19, + "output_name": "calcuts_cutoff" + }, + "function_select|input": { + "id": 14, + "output_name": "alignment_output" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "purge_dups_log", + "type": "txt" + }, + { + "name": "purge_dups_bed", + "type": "bed" + } + ], + "position": { + "left": 2461.203125, + "top": 1344.6875 + }, + "post_job_actions": { + "TagDatasetActionpurge_dups_bed": { + "action_arguments": { + "tags": "p1_purgeoverlap_bed" + }, + "action_type": "TagDatasetAction", + "output_name": "purge_dups_bed" + }, + "TagDatasetActionpurge_dups_log": { + "action_arguments": { + "tags": "p1_purgeoverlap_log" + }, + "action_type": "TagDatasetAction", + "output_name": "purge_dups_log" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"purge_dups\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}, \"coverage\": {\"__class__\": \"ConnectedValue\"}, \"cutoffs\": {\"__class__\": \"ConnectedValue\"}, \"min_bad\": \"0.8\", \"min_align\": \"70\", \"min_match\": \"200\", \"min_chain\": \"500\", \"max_gap\": \"20000\", \"double_chain\": {\"chaining_rounds\": \"one\", \"__current_case__\": 1}, \"min_chain_score\": \"10000\", \"max_extend\": \"15000\", \"log_file\": true}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "e724b339-6e6b-498c-a62f-33c1bf8d0a9b", + "when": null, + "workflow_outputs": [] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 21, + "input_connections": { + "function_select|bed_input": { + "id": 20, + "output_name": "purge_dups_bed" + }, + "function_select|fasta_input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "get_seqs_hap", + "type": "fasta" + }, + { + "name": "get_seqs_purged", + "type": "fasta" + } + ], + "position": { + "left": 2743.59375, + "top": 1214.046875 + }, + "post_job_actions": { + "RenameDatasetActionget_seqs_purged": { + "action_arguments": { + "newname": "Purged Primary Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "get_seqs_purged" + }, + "TagDatasetActionget_seqs_hap": { + "action_arguments": { + "tags": "seq_purged_p1" + }, + "action_type": "TagDatasetAction", + "output_name": "get_seqs_hap" + }, + "TagDatasetActionget_seqs_purged": { + "action_arguments": { + "tags": "p1" + }, + "action_type": "TagDatasetAction", + "output_name": "get_seqs_purged" + }, + "TagDatasetActionpurge_dups_bed": { + "action_arguments": { + "tags": "p1_purgeoverlap_bed" + }, + "action_type": "TagDatasetAction", + "output_name": "purge_dups_bed" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"get_seqs\", \"__current_case__\": 5, \"fasta_input\": {\"__class__\": \"ConnectedValue\"}, \"bed_input\": {\"__class__\": \"ConnectedValue\"}, \"advanced_options\": {\"coverage\": false, \"haplotigs\": false, \"length\": \"10000\", \"min_ratio\": \"0.05\", \"end_trim\": true, \"split\": false, \"min_gap\": \"10000\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "a25a74ec-9030-4852-88c4-60dc462cd364", + "when": null, + "workflow_outputs": [ + { + "label": "Purged Primary Assembly", + "output_name": "get_seqs_purged", + "uuid": "cba2e095-7c28-488c-ba6a-8fb2b1612bc1" + } + ] + }, + "22": { + "annotation": "", + "content_id": "cat1", + "errors": null, + "id": 22, + "input_connections": { + "input1": { + "id": 21, + "output_name": "get_seqs_hap" + }, + "queries_0|input2": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2961.796875, + "top": 1020.265625 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "RemoveTagDatasetActionout_file1": { + "action_arguments": { + "tags": "#p1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "cat1", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "b81b1694-8694-4b23-8cfe-ec2c92b36808", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "errors": null, + "id": 23, + "input_connections": { + "input": { + "id": 21, + "output_name": "get_seqs_purged" + }, + "lineage|lineage_dataset": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Busco", + "outputs": [ + { + "name": "busco_sum", + "type": "txt" + }, + { + "name": "busco_table", + "type": "tabular" + }, + { + "name": "busco_missing", + "type": "tabular" + }, + { + "name": "summary_image", + "type": "png" + } + ], + "position": { + "left": 3291.8282032055, + "top": 1520.4906962619295 + }, + "post_job_actions": { + "TagDatasetActionbusco_missing": { + "action_arguments": { + "tags": "busco_p1_missing, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_missing" + }, + "TagDatasetActionbusco_sum": { + "action_arguments": { + "tags": "busco_p1_summ, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_sum" + }, + "TagDatasetActionbusco_table": { + "action_arguments": { + "tags": "busco_p1_full, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_table" + }, + "TagDatasetActionsummary_image": { + "action_arguments": { + "tags": "busco_p1_img, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "summary_image" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "41030a6c03b7", + "name": "busco", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.3.2+galaxy0", + "type": "tool", + "uuid": "88073363-2f5c-4486-a23a-1cfdc4f5e6a6", + "when": null, + "workflow_outputs": [ + { + "label": "Busco on Purged Primary assembly: short summary", + "output_name": "busco_sum", + "uuid": "87515aeb-4e2e-494f-a271-44013d0944e4" + }, + { + "label": "Busco on Purged Primary assembly: summary image", + "output_name": "summary_image", + "uuid": "d1ecf9fe-3f76-465d-bcac-cf5b4986a8e8" + } + ] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 24, + "input_connections": { + "input_file": { + "id": 21, + "output_name": "get_seqs_purged" + }, + "mode_condition|swiss_army_knife": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 3644.462432861328, + "top": 1864.0125122070312 + }, + "post_job_actions": { + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "p1_gfa,PurgedPrimaryAssembly" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"gfa\", \"__current_case__\": 4, \"terminal_overlaps_condition\": {\"terminal_overlaps_select\": \"no\", \"__current_case__\": 0}}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "55a89d15-73d3-4e8b-b9da-06e650bd00cf", + "when": null, + "workflow_outputs": [ + { + "label": "Purged Primary Assembly (gfa)", + "output_name": "output", + "uuid": "e04e7950-3bcf-46e8-918c-781f71ef64c9" + } + ] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 25, + "input_connections": { + "input_file": { + "id": 21, + "output_name": "get_seqs_purged" + }, + "mode_condition|statistics_condition|expected_genomesize": { + "id": 13, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 4901.921875, + "top": 888.1875 + }, + "post_job_actions": { + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_p1, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"assembly\", \"__current_case__\": 2, \"expected_genomesize\": {\"__class__\": \"ConnectedValue\"}}, \"locale\": true, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "68dd6694-1839-4ec3-b258-c30a35901ebf", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 26, + "input_connections": { + "input_file": { + "id": 21, + "output_name": "get_seqs_purged" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 4901.984375, + "top": 1122.796875 + }, + "post_job_actions": { + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_contigs_p1, #p1" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"size\", \"__current_case__\": 0, \"out_size\": \"c\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "2a8b5983-7a56-420d-9825-5ba18ac1e560", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "errors": null, + "id": 27, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 0, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 22, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 3260.375, + "top": 655.015625 + }, + "post_job_actions": { + "ChangeDatatypeActionalignment_output": { + "action_arguments": { + "newtype": "paf" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "alignment_output" + }, + "TagDatasetActionalignment_output": { + "action_arguments": { + "tags": "readCoverage" + }, + "action_type": "TagDatasetAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "tool_shed_repository": { + "changeset_revision": "11a0d50a54e6", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"asm5\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.24+galaxy0", + "type": "tool", + "uuid": "895ca00e-3eaf-4c8a-9147-be1d62459cf9", + "when": null, + "workflow_outputs": [] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 28, + "input_connections": { + "function_select|input": { + "id": 22, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "split_fasta", + "type": "fasta" + } + ], + "position": { + "left": 3281.28125, + "top": 919.71875 + }, + "post_job_actions": { + "HideDatasetActionsplit_fasta": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "split_fasta" + }, + "RemoveTagDatasetActionsplit_fasta": { + "action_arguments": { + "tags": "#p1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "split_fasta" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"split_fa\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "f14c9eb4-89f8-4697-9267-ea58035a9126", + "when": null, + "workflow_outputs": [] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 29, + "input_connections": { + "infile": { + "id": 25, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 5244.5625, + "top": 1132.484375 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"BEGIN{print \\\"Metric\\\\tPrimary\\\"}; {print}; \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "8ad0b9e5-e002-402d-9d3a-ec20c331f864", + "when": null, + "workflow_outputs": [] + }, + "30": { + "annotation": "", + "id": 30, + "input_connections": { + "gfa_stats": { + "id": 26, + "input_subworkflow_step_id": 0, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_data_prep", + "outputs": [], + "position": { + "left": 5770.71875, + "top": 329.78125 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "gfastats_data_prep", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "gfa_stats" + } + ], + "label": "gfa_stats", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 189.90056800842285 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "6f1d6192-d1ef-4117-b3af-436b08bffb72", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "sort1", + "errors": null, + "id": 1, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 302.6136245727539, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "sort1", + "tool_state": "{\"column\": \"2\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"DESC\", \"style\": \"num\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "3000707c-422b-4e57-b965-b06a7b9d824a", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 1, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 292.1306838989258, + "top": 235.1562442779541 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{total += $2; $3 = total}1\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "eb19b23a-04eb-4cf6-8389-ca7c21458194", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "in_file": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 595.0994338989258, + "top": 116.0227222442627 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "746e8e4bf929", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0+galaxy2", + "type": "tool", + "uuid": "4beb22a7-74f7-4dff-abf9-3d1bfd263ecd", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "addValue", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 479.0482864379883, + "top": 456.17896461486816 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "addValue", + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "fdf47dde-b43d-431e-a8a4-7f476ada62ae", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 693.4658889770508, + "top": 299.4318027496338 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "f7687678-170e-4287-973d-ee285e5a4d62", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "components_1|param_type|component_value": { + "id": 5, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 885.0994338989258, + "top": 493.36646461486816 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c3/\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "9e083ec1-ee5c-4aa0-83e8-2d4f01db18ca", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "ops|expressions_0|cond": { + "id": 6, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1115.0993728637695, + "top": 735.5255222320557 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "gfastats data for plotting" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "9cab2e16-083c-48ed-ada3-566c9639e819", + "when": null, + "workflow_outputs": [ + { + "label": "gfastats data for plotting", + "output_name": "out_file1", + "uuid": "5156457e-0da2-4478-a298-7b4612d7e311" + } + ] + } + }, + "tags": "", + "uuid": "fc06c797-a464-417a-8988-078c14041cc5" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "509bf106-157c-4565-b2fc-bf28b3818a10", + "when": null, + "workflow_outputs": [] + }, + "31": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 31, + "input_connections": { + "function_select|input": { + "id": 27, + "output_name": "alignment_output" + }, + "function_select|section_calcuts|transition": { + "id": 18, + "output_name": "integer_param" + }, + "function_select|section_calcuts|upper_depth": { + "id": 17, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "stat_file", + "type": "tabular" + }, + { + "name": "pbcstat_cov", + "type": "tabular" + }, + { + "name": "pbcstat_wig", + "type": "wig" + }, + { + "name": "hist", + "type": "png" + }, + { + "name": "calcuts_log", + "type": "txt" + }, + { + "name": "calcuts_cutoff", + "type": "tabular" + } + ], + "position": { + "left": 3621.0345942870044, + "top": 361.0156407387206 + }, + "post_job_actions": { + "TagDatasetActioncalcuts_cutoff": { + "action_arguments": { + "tags": "p2_calcuts_cutoffs" + }, + "action_type": "TagDatasetAction", + "output_name": "calcuts_cutoff" + }, + "TagDatasetActioncalcuts_log": { + "action_arguments": { + "tags": " p2_calcuts_log" + }, + "action_type": "TagDatasetAction", + "output_name": "calcuts_log" + }, + "TagDatasetActionhist": { + "action_arguments": { + "tags": "p2_calcuts_hist" + }, + "action_type": "TagDatasetAction", + "output_name": "hist" + }, + "TagDatasetActionpbcstat_cov": { + "action_arguments": { + "tags": "p2_calcuts_basecov" + }, + "action_type": "TagDatasetAction", + "output_name": "pbcstat_cov" + }, + "TagDatasetActionpbcstat_wig": { + "action_arguments": { + "tags": " p2_calcuts_basecov_wig" + }, + "action_type": "TagDatasetAction", + "output_name": "pbcstat_wig" + }, + "TagDatasetActionpurge_dups_bed": { + "action_arguments": { + "tags": "p2_purgeoverlap_bed" + }, + "action_type": "TagDatasetAction", + "output_name": "purge_dups_bed" + }, + "TagDatasetActionstat_file": { + "action_arguments": { + "tags": "p2_calcuts_depths" + }, + "action_type": "TagDatasetAction", + "output_name": "stat_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"pbcstat\", \"__current_case__\": 2, \"input\": {\"__class__\": \"ConnectedValue\"}, \"pbcstat_options\": {\"max_cov\": \"500\", \"min_map_ratio\": \"0.0\", \"min_map_qual\": null, \"flank\": \"0\", \"primary_alignments\": true}, \"section_calcuts\": {\"min_depth\": \"0.1\", \"low_depth\": \"1\", \"transition\": {\"__class__\": \"ConnectedValue\"}, \"upper_depth\": {\"__class__\": \"ConnectedValue\"}, \"ploidy\": \"-d 0\"}, \"section_hist\": {\"ymin\": null, \"ymax\": null, \"xmin\": null, \"xmax\": null, \"title\": \"Read depth histogram plot\"}, \"output_options\": [\"pbcstat_coverage\", \"pbcstat_wig\", \"depth_stats\", \"histogram\", \"calcuts_cutoff\", \"calcuts_log\"]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "0496de4b-ec62-48d5-8c36-e2f946ca728d", + "when": null, + "workflow_outputs": [ + { + "label": "Cutoffs for alternate assembly", + "output_name": "calcuts_cutoff", + "uuid": "49bf0c95-0290-4f8b-a9d7-2f17f53e9d26" + }, + { + "label": "Read Coverage and cutoffs calculation on alternate assembly : Histogram Plot", + "output_name": "hist", + "uuid": "f12c1cc7-a12a-4314-ae16-2738b80afe70" + } + ] + }, + "32": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "errors": null, + "id": 32, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 28, + "output_name": "split_fasta" + }, + "reference_source|ref_file": { + "id": 28, + "output_name": "split_fasta" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 3654.1873833982727, + "top": 1119.7760517221939 + }, + "post_job_actions": { + "ChangeDatatypeActionalignment_output": { + "action_arguments": { + "newtype": "paf" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "alignment_output" + }, + "TagDatasetActionalignment_output": { + "action_arguments": { + "tags": "SelfvsSelf" + }, + "action_type": "TagDatasetAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.24+galaxy0", + "tool_shed_repository": { + "changeset_revision": "11a0d50a54e6", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": \"1\", \"B\": \"19\", \"O\": \"39\", \"O2\": \"81\", \"E\": \"3\", \"E2\": \"1\", \"z\": \"200\", \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"self-homology\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"paf\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": \"100\", \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": \"40\", \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.24+galaxy0", + "type": "tool", + "uuid": "735ef0da-2e48-404e-b57d-837dc2f161fd", + "when": null, + "workflow_outputs": [] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 33, + "input_connections": { + "function_select|coverage": { + "id": 31, + "output_name": "pbcstat_cov" + }, + "function_select|cutoffs": { + "id": 31, + "output_name": "calcuts_cutoff" + }, + "function_select|input": { + "id": 32, + "output_name": "alignment_output" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "purge_dups_log", + "type": "txt" + }, + { + "name": "purge_dups_bed", + "type": "bed" + } + ], + "position": { + "left": 3932.46875, + "top": 743.21875 + }, + "post_job_actions": { + "TagDatasetActionpurge_dups_bed": { + "action_arguments": { + "tags": "p2_purgeoverlap_bed" + }, + "action_type": "TagDatasetAction", + "output_name": "purge_dups_bed" + }, + "TagDatasetActionpurge_dups_log": { + "action_arguments": { + "tags": "p2_purgeoverlap_log" + }, + "action_type": "TagDatasetAction", + "output_name": "purge_dups_log" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"purge_dups\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}, \"coverage\": {\"__class__\": \"ConnectedValue\"}, \"cutoffs\": {\"__class__\": \"ConnectedValue\"}, \"min_bad\": \"0.8\", \"min_align\": \"70\", \"min_match\": \"200\", \"min_chain\": \"500\", \"max_gap\": \"20000\", \"double_chain\": {\"chaining_rounds\": \"one\", \"__current_case__\": 1}, \"min_chain_score\": \"10000\", \"max_extend\": \"15000\", \"log_file\": true}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "065dcba7-a905-4fc2-8cec-0da64f2cae80", + "when": null, + "workflow_outputs": [] + }, + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "errors": null, + "id": 34, + "input_connections": { + "function_select|bed_input": { + "id": 33, + "output_name": "purge_dups_bed" + }, + "function_select|fasta_input": { + "id": 22, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Purge overlaps", + "outputs": [ + { + "name": "get_seqs_hap", + "type": "fasta" + }, + { + "name": "get_seqs_purged", + "type": "fasta" + } + ], + "position": { + "left": 4197.723070656268, + "top": 960.092407647382 + }, + "post_job_actions": { + "RenameDatasetActionget_seqs_purged": { + "action_arguments": { + "newname": "Purged Alternate assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "get_seqs_purged" + }, + "TagDatasetActionget_seqs_hap": { + "action_arguments": { + "tags": "seq_purged_p2" + }, + "action_type": "TagDatasetAction", + "output_name": "get_seqs_hap" + }, + "TagDatasetActionget_seqs_purged": { + "action_arguments": { + "tags": "p2" + }, + "action_type": "TagDatasetAction", + "output_name": "get_seqs_purged" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/purge_dups/purge_dups/1.2.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "e9bd16ba5ebd", + "name": "purge_dups", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function_select\": {\"functions\": \"get_seqs\", \"__current_case__\": 5, \"fasta_input\": {\"__class__\": \"ConnectedValue\"}, \"bed_input\": {\"__class__\": \"ConnectedValue\"}, \"advanced_options\": {\"coverage\": false, \"haplotigs\": false, \"length\": \"10000\", \"min_ratio\": \"0.05\", \"end_trim\": true, \"split\": false, \"min_gap\": \"10000\"}}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.6+galaxy0", + "type": "tool", + "uuid": "d38860b9-4bad-4498-b76f-7c5da1d91de0", + "when": null, + "workflow_outputs": [ + { + "label": "Purged Alternate assembly", + "output_name": "get_seqs_purged", + "uuid": "fc24cb81-cb83-4d9e-8e22-d2e967409f1e" + } + ] + }, + "35": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 35, + "input_connections": { + "input_file": { + "id": 34, + "output_name": "get_seqs_purged" + }, + "mode_condition|statistics_condition|expected_genomesize": { + "id": 13, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 4892.625, + "top": 450.3125 + }, + "post_job_actions": { + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_p2, #p2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"assembly\", \"__current_case__\": 2, \"expected_genomesize\": {\"__class__\": \"ConnectedValue\"}}, \"locale\": true, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "6ddef707-fe4d-4020-bebb-2ab9b262df62", + "when": null, + "workflow_outputs": [] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 36, + "input_connections": { + "input_file": { + "id": 34, + "output_name": "get_seqs_purged" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 4901.046875, + "top": 679.71875 + }, + "post_job_actions": { + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_contigs_p2, #p2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"size\", \"__current_case__\": 0, \"out_size\": \"c\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "d6ed7c62-c214-4856-a926-2985b003dbd9", + "when": null, + "workflow_outputs": [] + }, + "37": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "errors": null, + "id": 37, + "input_connections": { + "mode|assembly_options|assembly_01": { + "id": 21, + "output_name": "get_seqs_purged" + }, + "mode|assembly_options|assembly_02": { + "id": 34, + "output_name": "get_seqs_purged" + }, + "mode|meryldb_F1": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Merqury", + "outputs": [ + { + "name": "qv_files", + "type": "input" + }, + { + "name": "png_files", + "type": "input" + }, + { + "name": "stats_files", + "type": "input" + }, + { + "name": "log_file", + "type": "txt" + } + ], + "position": { + "left": 4751.9375, + "top": 1420.140625 + }, + "post_job_actions": { + "HideDatasetActionlog_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "log_file" + }, + "TagDatasetActionbed_files": { + "action_arguments": { + "tags": "merqury_p_bed, #p" + }, + "action_type": "TagDatasetAction", + "output_name": "bed_files" + }, + "TagDatasetActionpng_files": { + "action_arguments": { + "tags": "merqury_p_png, #p" + }, + "action_type": "TagDatasetAction", + "output_name": "png_files" + }, + "TagDatasetActionqv_files": { + "action_arguments": { + "tags": "merqury_p_qv, #p" + }, + "action_type": "TagDatasetAction", + "output_name": "qv_files" + }, + "TagDatasetActionsizes_files": { + "action_arguments": { + "tags": "merqury_p_sizes, #p" + }, + "action_type": "TagDatasetAction", + "output_name": "sizes_files" + }, + "TagDatasetActionstats_files": { + "action_arguments": { + "tags": "merqury_p_stats, #p" + }, + "action_type": "TagDatasetAction", + "output_name": "stats_files" + }, + "TagDatasetActionwig_files": { + "action_arguments": { + "tags": "merqury_p_wig, #p" + }, + "action_type": "TagDatasetAction", + "output_name": "wig_files" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f8113c25bc6b", + "name": "merqury", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"label\": \"output_merqury\", \"mode\": {\"options\": \"default\", \"__current_case__\": 0, \"meryldb_F1\": {\"__class__\": \"ConnectedValue\"}, \"assembly_options\": {\"number_assemblies\": \"two\", \"__current_case__\": 1, \"assembly_01\": {\"__class__\": \"ConnectedValue\"}, \"assembly_02\": {\"__class__\": \"ConnectedValue\"}}}, \"output_add_headers\": false, \"output_selector\": [\"qv\", \"plots\", \"stats\", \"log\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3+galaxy2", + "type": "tool", + "uuid": "133c60bc-4171-44b4-bf22-c70c623265b2", + "when": null, + "workflow_outputs": [ + { + "label": "Merqury on Phased assemblies: stats", + "output_name": "stats_files", + "uuid": "70f44477-6a3b-4ac4-b01a-f812ea880bae" + }, + { + "label": "Merqury on Phased assemblies: Images", + "output_name": "png_files", + "uuid": "ff9cfc96-449e-41d8-9c10-7f586ab6f479" + } + ] + }, + "38": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 38, + "input_connections": { + "input_file": { + "id": 34, + "output_name": "get_seqs_purged" + }, + "mode_condition|swiss_army_knife": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 5044.787384033203, + "top": 1348.112548828125 + }, + "post_job_actions": { + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "p2_gfa,PurgedAlternateAssembly" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"gfa\", \"__current_case__\": 4, \"terminal_overlaps_condition\": {\"terminal_overlaps_select\": \"no\", \"__current_case__\": 0}}, \"discover_paths\": true, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "f15eb7b7-c881-490b-8734-cc4d934eaa3a", + "when": null, + "workflow_outputs": [ + { + "label": "Purged Alternate assembly (gfa)", + "output_name": "output", + "uuid": "5323cc49-9368-44f9-b1db-e027bcc77abd" + } + ] + }, + "39": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 39, + "input_connections": { + "infile": { + "id": 35, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 5259.546875, + "top": 708.5 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"BEGIN{print \\\"Metric\\\\tAlternate\\\"}; {print}; \", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "ed133b72-e945-4fe5-91d6-c71efa30678c", + "when": null, + "workflow_outputs": [] + }, + "40": { + "annotation": "", + "id": 40, + "input_connections": { + "gfa_stats": { + "id": 36, + "input_subworkflow_step_id": 0, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_data_prep", + "outputs": [], + "position": { + "left": 5766.390625, + "top": 526.78125 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "gfastats_data_prep", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "gfa_stats" + } + ], + "label": "gfa_stats", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 189.90056800842285 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "56311775-399e-4e9e-aa48-8fa9fff12ad3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "sort1", + "errors": null, + "id": 1, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 302.6136245727539, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "sort1", + "tool_state": "{\"column\": \"2\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"DESC\", \"style\": \"num\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "7a31b528-ee29-4b2a-9270-6ae34ce198ef", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 1, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 292.1306838989258, + "top": 235.1562442779541 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{total += $2; $3 = total}1\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "1a29dcd8-0ecd-4e4b-b7c4-ba688290eef3", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "in_file": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 595.0994338989258, + "top": 116.0227222442627 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "746e8e4bf929", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0+galaxy2", + "type": "tool", + "uuid": "053d0561-98e5-46b2-b554-685802fdb0ed", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "addValue", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 479.0482864379883, + "top": 456.17896461486816 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "addValue", + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "3b744e29-af55-4a10-9e56-bb637456ef54", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 693.4658889770508, + "top": 299.4318027496338 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "b66fba8c-0e58-44ae-97eb-38fa3b408904", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "components_1|param_type|component_value": { + "id": 5, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 885.0994338989258, + "top": 493.36646461486816 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c3/\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "0477114d-32f5-4560-a3c5-3995c4cd8469", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "ops|expressions_0|cond": { + "id": 6, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1115.0993728637695, + "top": 735.5255222320557 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "gfastats data for plotting" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "602d39d3-ab8c-4f94-9119-f04ca5d2e750", + "when": null, + "workflow_outputs": [ + { + "label": "gfastats data for plotting", + "output_name": "out_file1", + "uuid": "38ba0514-f27a-45fd-889b-5778f32e5ec6" + } + ] + } + }, + "tags": "", + "uuid": "f6fd4bb1-18de-4746-accd-18cf86ee25f8" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "71a56572-9780-41fd-a92a-9f306d93ac29", + "when": null, + "workflow_outputs": [] + }, + "41": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/1.1.2", + "errors": null, + "id": 41, + "input_connections": { + "infile1": { + "id": 29, + "output_name": "outfile" + }, + "infile2": { + "id": 39, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Join", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 5652.5625, + "top": 850.46875 + }, + "post_job_actions": { + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "gfastats_p1_p2" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_easyjoin_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"column1\": \"1\", \"column2\": \"1\", \"empty_string_filler\": \"0\", \"header\": true, \"ignore_case\": false, \"infile1\": {\"__class__\": \"ConnectedValue\"}, \"infile2\": {\"__class__\": \"ConnectedValue\"}, \"jointype\": \"-a 1 -a 2\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "c620558f-324d-40cf-86b6-7460b52d49bf", + "when": null, + "workflow_outputs": [ + { + "label": "Assembly stats on Primary and alternate assemblies", + "output_name": "output", + "uuid": "36aaeacd-4752-43cb-9000-f859290c9ed2" + } + ] + }, + "42": { + "annotation": "", + "id": 42, + "input_connections": { + "Alternate data": { + "id": 40, + "input_subworkflow_step_id": 1, + "output_name": "gfastats data for plotting" + }, + "Name of alternate assembly": { + "id": 9, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Name of primary assembly": { + "id": 8, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Primary data": { + "id": 30, + "input_subworkflow_step_id": 0, + "output_name": "gfastats data for plotting" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_plot", + "outputs": [], + "position": { + "left": 6127.71875, + "top": 374.140625 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "creator": [ + { + "class": "Organization", + "name": "Galaxy" + }, + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + } + ], + "format-version": "0.1", + "license": "CC-BY-4.0", + "name": "gfastats_plot", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Primary data" + } + ], + "label": "Primary data", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 0.0 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "bb14a035-f95c-4e8e-864a-6b69caad5a89", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Alternate data" + } + ], + "label": "Alternate data", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 6.960205078125, + "top": 143.53692626953125 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "262f039f-40c5-41c2-a36d-adcb840aea19", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of primary assembly" + } + ], + "label": "Name of primary assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 4.55963134765625, + "top": 296.3210144042969 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Primary\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "1e24b121-b6e3-4478-b8c4-badfb50cf30e", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "74a3fc5f-212c-43d5-adc2-103f490fa766" + } + ] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name of alternate assembly" + } + ], + "label": "Name of alternate assembly", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 7.428955078125, + "top": 440.4403076171875 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Alternate\", \"parameter_type\": \"text\", \"optional\": true}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c2411d50-9786-4ff3-b316-5d60334dc340", + "when": null, + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "b886bb65-a905-4e2c-b6de-ae3dcc3749d7" + } + ] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "errors": null, + "id": 4, + "input_connections": { + "exp": { + "id": 2, + "output_name": "output" + }, + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1139.7584686279297, + "top": 107.42897033691406 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_shed_repository": { + "changeset_revision": "745871c0b055", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "0fde4e58-dadf-4c75-8231-d5c838c05710", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "errors": null, + "id": 5, + "input_connections": { + "exp": { + "id": 3, + "output_name": "output" + }, + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1151.7044982910156, + "top": 392.65625 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.0", + "tool_shed_repository": { + "changeset_revision": "745871c0b055", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "f8602bb7-6924-4b52-932b-b862f5698ae0", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "inputs": { + "id": 4, + "output_name": "out_file1" + }, + "queries_0|inputs2": { + "id": 5, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1441.193115234375, + "top": 216.59091186523438 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1", + "tool_shed_repository": { + "changeset_revision": "d698c222f354", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputs\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"inputs2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "a2dc3c75-6398-4a22-bbd1-254fa1112764", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 6, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1780.3265991210938, + "top": 182.99716186523438 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c8,c5,c6\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "fc421b7d-5c43-4bef-8904-b08a79f517e6", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 8, + "input_connections": { + "input": { + "id": 6, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1781.349365234375, + "top": 387.96875 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c8,c4,c7\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "91e26e50-21d0-4380-bf84-a5bacef80541", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 9, + "input_connections": { + "input1": { + "id": 7, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], + "label": "Nx Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 2068.1390991210938, + "top": 31.988632202148438 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Nx Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#nx_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"x\", \"xplot\": \"2\", \"ylab\": \"Nx (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "80c6d25c-25e8-41dd-9f73-10aeda771d1d", + "when": null, + "workflow_outputs": [ + { + "label": "Nx Plot", + "output_name": "output1", + "uuid": "10ea479b-6055-4295-ab4d-b4a3448ba241" + } + ] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 10, + "input_connections": { + "input1": { + "id": 8, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Scatterplot with ggplot2", + "name": "input1" + } + ], + "label": "Size Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 2083.3805541992188, + "top": 319.8011169433594 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Size Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#size_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Single\", \"__current_case__\": 1, \"factorcol\": \"1\", \"colors\": \"Set1\", \"colororder\": \"1\"}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"RuntimeValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"Scaffold number\", \"xplot\": \"2\", \"ylab\": \"Cumulative Size (Mb)\", \"yplot\": \"3\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "d8440c79-e959-4f80-95ad-4b903c987979", + "when": null, + "workflow_outputs": [ + { + "label": "Size Plot", + "output_name": "output1", + "uuid": "59e0d92b-8e0f-4e97-b6be-8656f1721abf" + } + ] + } + }, + "tags": "", + "uuid": "d69cbb39-0517-4055-b17b-25389e0cf725" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "78a19ed6-ca17-4b55-9822-bd7bb42a4b22", + "when": null, + "workflow_outputs": [ + { + "label": "Nx Plot", + "output_name": "Nx Plot", + "uuid": "a15bf8fc-7eae-497b-9f75-ddaf474ade51" + }, + { + "label": "Size Plot", + "output_name": "Size Plot", + "uuid": "b5516866-8b4f-41b8-a19a-12e1362d344c" + } + ] + } + }, + "tags": [ + "VGP_curated" + ], + "uuid": "f27cdddd-45d6-4fb4-bb18-9d468cbc437c", + "version": 2 +} \ No newline at end of file diff --git a/topics/assembly/tutorials/vgp_workflow_training/workflows/wf8-scaffolding-HiC.ga b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf8-scaffolding-HiC.ga new file mode 100644 index 00000000000000..c64c89437e313b --- /dev/null +++ b/topics/assembly/tutorials/vgp_workflow_training/workflows/wf8-scaffolding-HiC.ga @@ -0,0 +1,1999 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "Scaffolding using HiC data with YAHS.", + "creator": [ + { + "class": "Organization", + "name": "VGP", + "url": "https://vertebrategenomeproject.org" + }, + { + "class": "Organization", + "name": "Galaxy" + } + ], + "format-version": "0.1", + "release": "0.1.1", + "license": "CC-BY-4.0", + "name": "Scaffolding-HiC-VGP8", + "steps": { + "0": { + "annotation": "The input GFA must conform to gfa1.2 standards, i.e. should have 'P' lines defined. Output GFAs from assemblers can be run through a GFA->GFA conversion using gfastats to ensure this. ", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "The input GFA must conform to gfa1.2 standards, i.e. should have 'P' lines defined. Output GFAs from assemblers can be run through a GFA->GFA conversion using gfastats to ensure this. ", + "name": "input GFA" + } + ], + "label": "input GFA", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 218.015625 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "48622cc7-df63-4c71-8a1c-f0d2d326504d", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Sequence graph" + } + ], + "label": "Sequence graph", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 36.390625, + "top": 392.96875 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "6b5dfbf0-36da-4489-9f50-23c55ae5762f", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "Provide lineage for BUSCO (e.g. Vertebrata)", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "Provide lineage for BUSCO (e.g. Vertebrata)", + "name": "Lineage" + } + ], + "label": "Lineage", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 28.5, + "top": 487.5 + }, + "tool_id": null, + "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "e76f50b3-d497-4f51-884c-0dc181592f8f", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "HiC Forward reads" + } + ], + "label": "HiC Forward reads", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 24.828125, + "top": 566.625 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fastqsanger\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "89a3dfc3-42c4-4c08-a221-7f3f844af0a4", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "HiC reverse reads" + } + ], + "label": "HiC reverse reads", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 25.359375, + "top": 673.9453125 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fastqsanger\"], \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "3128533f-206a-41f0-9911-98b88e4f8714", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Restriction enzymes" + } + ], + "label": "Restriction enzymes", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 34.3125, + "top": 786.015625 + }, + "tool_id": null, + "tool_state": "{\"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "68e8d6b9-f48f-4c78-a603-0623af75111e", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Estimated genome size - Parameter File" + } + ], + "label": "Estimated genome size - Parameter File", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 51.203125, + "top": 915.09375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "b9768cf7-430a-4465-adc8-45497954f036", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "SAK input file" + } + ], + "label": "SAK input file", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 61.953125, + "top": 1019.3125 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "6067a21b-a403-4fef-9c9a-184b219a2924", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "input_file": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool gfastats", + "name": "mode_condition" + } + ], + "label": "Input GFA", + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 313.7494048848895, + "top": 205.4228884397875 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"RuntimeValue\"}, \"output_condition\": {\"out_format\": \"fasta\", \"__current_case__\": 0, \"line_length\": null}, \"discover_paths\": false, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "8deee312-a278-47e6-9167-0dce37d5b65c", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 9, + "input_connections": { + "input1": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 2543.6767497455858, + "top": 1694.171875 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "8429fbf7-96d5-4b20-b90a-b794792c26c5", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "errors": null, + "id": 10, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 3, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 1397.067374745586, + "top": 515.859375 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "b4a22d90cce9", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.2.1+galaxy0", + "type": "tool", + "uuid": "1c192fd2-daba-46ad-8b98-4ab0bf1404ba", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 4, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 1306.239249745586, + "top": 956.0625 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "b4a22d90cce9", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.2.1+galaxy0", + "type": "tool", + "uuid": "5ea17098-2a3b-4fba-a2e1-4e3a8c4430ab", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", + "errors": null, + "id": 12, + "input_connections": { + "forward": { + "id": 10, + "output_name": "bam_output" + }, + "reverse": { + "id": 11, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Filter and merge", + "outputs": [ + { + "name": "outfile", + "type": "bam" + } + ], + "position": { + "left": 1639.145499745586, + "top": 753.28125 + }, + "post_job_actions": { + "TagDatasetActionoutfile": { + "action_arguments": { + "tags": "merged_alignments_s1" + }, + "action_type": "TagDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "25ca5d73aedf", + "name": "bellerophon", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"forward\": {\"__class__\": \"ConnectedValue\"}, \"quality\": \"20\", \"reverse\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0+galaxy0", + "type": "tool", + "uuid": "e7b502ef-c2a7-4b14-b4fe-d88938577974", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", + "errors": null, + "id": 13, + "input_connections": { + "input": { + "id": 12, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 1897.4047444924045, + "top": 981.2891393226516 + }, + "post_job_actions": { + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "pretextmap_s1, #s1" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "dfb8a4497339", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": null, \"sorting\": {\"sortby\": \"nosort\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.9+galaxy0", + "type": "tool", + "uuid": "6d280ad6-6803-44c3-8afe-5b5ff424c98d", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/yahs/yahs/1.2a.2+galaxy0", + "errors": null, + "id": 14, + "input_connections": { + "function|agp": { + "id": 1, + "output_name": "output" + }, + "function|bfile": { + "id": 12, + "output_name": "outfile" + }, + "function|enzyme_conditional|preconfigured_enzymes": { + "id": 5, + "output_name": "output" + }, + "function|fasta": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "YAHS", + "outputs": [ + { + "name": "initial_agp_break", + "type": "input" + }, + { + "name": "agp_break", + "type": "input" + }, + { + "name": "agp_out", + "type": "input" + }, + { + "name": "final_agp_out", + "type": "agp" + }, + { + "name": "final_fasta_out", + "type": "fasta" + }, + { + "name": "log_file", + "type": "txt" + } + ], + "position": { + "left": 2423.5204997455858, + "top": 0 + }, + "post_job_actions": { + "TagDatasetActionfinal_agp_out": { + "action_arguments": { + "tags": "s2_agp, #s2" + }, + "action_type": "TagDatasetAction", + "output_name": "final_agp_out" + }, + "TagDatasetActionfinal_fasta_out": { + "action_arguments": { + "tags": "s2_fasta, #s2" + }, + "action_type": "TagDatasetAction", + "output_name": "final_fasta_out" + }, + "TagDatasetActionlog_file": { + "action_arguments": { + "tags": "s2_log, #s2" + }, + "action_type": "TagDatasetAction", + "output_name": "log_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/yahs/yahs/1.2a.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "39495e107274", + "name": "yahs", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"function\": {\"function_select\": \"yahs\", \"__current_case__\": 0, \"fasta\": {\"__class__\": \"ConnectedValue\"}, \"bfile\": {\"__class__\": \"ConnectedValue\"}, \"agp\": {\"__class__\": \"ConnectedValue\"}, \"res\": \"\", \"enzyme_conditional\": {\"enzyme_options\": \"preconfigured\", \"__current_case__\": 1, \"preconfigured_enzymes\": {\"__class__\": \"ConnectedValue\"}}, \"length\": null, \"quality\": null, \"no_contig_ec\": true, \"no_scaffold_ec\": false}, \"log_out\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2a.2+galaxy0", + "type": "tool", + "uuid": "204fe2a0-4486-4dde-90b1-560aa909eb33", + "when": null, + "workflow_outputs": [ + { + "label": "YAHS on input dataset(s): Final scaffolds agp output", + "output_name": "final_agp_out", + "uuid": "8f9d422b-3f0f-47f4-a1f3-d957a5f49118" + } + ] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", + "errors": null, + "id": 15, + "input_connections": { + "input": { + "id": 13, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 2167.5204997455858, + "top": 971.375 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + }, + "TagDatasetActionpretext_snap_out": { + "action_arguments": { + "tags": "pretext_s1" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "44c66e8d21e6", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"5\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": true, \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"1000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.0.3+galaxy1", + "type": "tool", + "uuid": "ad7305d0-d613-4203-8ae8-d8ca469eddd5", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 16, + "input_connections": { + "input_file": { + "id": 8, + "output_name": "output" + }, + "mode_condition|agp_to_path": { + "id": 14, + "output_name": "final_agp_out" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 2766.6454997455858, + "top": 128.703125 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Reconciliated Scaffolds: gfa" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "s2_gfa" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"scaffolding\", \"__current_case__\": 2, \"agp_to_path\": {\"__class__\": \"ConnectedValue\"}, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "95290218-32e1-4466-9511-e9822154d3dd", + "when": null, + "workflow_outputs": [ + { + "label": "Reconciliated Scaffolds: gfa", + "output_name": "output", + "uuid": "671d3d09-a7ab-496c-a3a1-3b3fe8675ffd" + } + ] + }, + "17": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 17, + "input_connections": { + "input": { + "id": 15, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 2537.7392497455858, + "top": 1090.8125 + }, + "post_job_actions": { + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_s1" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.1", + "type": "tool", + "uuid": "081cea0b-17fd-49f1-8774-c6a5029e7a5b", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Map Before HiC scaffolding", + "output_name": "output", + "uuid": "f6f4e543-5204-43c8-b867-62775fc8cea5" + } + ] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 18, + "input_connections": { + "input_file": { + "id": 16, + "output_name": "output" + }, + "mode_condition|swiss_army_knife": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 3191.0048747455858, + "top": 324.421875 + }, + "post_job_actions": { + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "s2_fasta" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"fasta\", \"__current_case__\": 0, \"line_length\": null}, \"discover_paths\": false, \"sort\": \"\", \"homopolymer_compress\": null}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "38257089-cca2-46d0-9e44-322dceebec42", + "when": null, + "workflow_outputs": [ + { + "label": "Reconciliated Scaffolds: fasta", + "output_name": "output", + "uuid": "d1a62645-80b0-4939-baa6-f3fcf982085e" + } + ] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 19, + "input_connections": { + "input_file": { + "id": 16, + "output_name": "output" + }, + "mode_condition|statistics_condition|expected_genomesize": { + "id": 9, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 3650.5361247455858, + "top": 1761.203125 + }, + "post_job_actions": { + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_asm_s2, #s2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"assembly\", \"__current_case__\": 2, \"expected_genomesize\": {\"__class__\": \"ConnectedValue\"}}, \"locale\": true, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "2207f3c6-a651-42ba-b6e7-350c9c6a2db7", + "when": null, + "workflow_outputs": [ + { + "label": "Assembly Statistics for s2", + "output_name": "stats", + "uuid": "ee8af1cd-1535-4f63-a17b-e57ca1cb47b3" + } + ] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "input_file": { + "id": 16, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 3778.1923747455858, + "top": 1568.171875 + }, + "post_job_actions": { + "TagDatasetActionstats": { + "action_arguments": { + "tags": "gfastats_scaffolds_s2, #s2" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0", + "tool_shed_repository": { + "changeset_revision": "3ef480892a9f", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"size\", \"__current_case__\": 0, \"out_size\": \"s\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.3.6+galaxy0", + "type": "tool", + "uuid": "0fc8b3a2-550f-4891-aa05-a1cea35f0b5e", + "when": null, + "workflow_outputs": [ + { + "label": "Scaffold sizes for s2", + "output_name": "stats", + "uuid": "17e925f3-e890-4608-b9fb-b9b83b2a120a" + } + ] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "errors": null, + "id": 21, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 3, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 18, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 3437.8954997455858, + "top": 550.453125 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "b4a22d90cce9", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.2.1+galaxy0", + "type": "tool", + "uuid": "e68b1c36-8731-4c75-8f04-2eab2fad5f3e", + "when": null, + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "errors": null, + "id": 22, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 4, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 18, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 3436.7392497455858, + "top": 828.171875 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.2.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "b4a22d90cce9", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"analysis_type\": {\"analysis_type_selector\": \"illumina\", \"__current_case__\": 0}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 1, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.2.1+galaxy0", + "type": "tool", + "uuid": "62e9129f-bfd9-4583-8174-3459bd03729a", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "errors": null, + "id": 23, + "input_connections": { + "input": { + "id": 18, + "output_name": "output" + }, + "lineage|lineage_dataset": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Busco", + "outputs": [ + { + "name": "busco_sum", + "type": "txt" + }, + { + "name": "busco_table", + "type": "tabular" + }, + { + "name": "busco_missing", + "type": "tabular" + }, + { + "name": "summary_image", + "type": "png" + } + ], + "position": { + "left": 3723.53125, + "top": 276.07421875 + }, + "post_job_actions": { + "TagDatasetActionbusco_missing": { + "action_arguments": { + "tags": "busco_s2_missing" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_missing" + }, + "TagDatasetActionbusco_sum": { + "action_arguments": { + "tags": "busco_s2_summ" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_sum" + }, + "TagDatasetActionbusco_table": { + "action_arguments": { + "tags": " busco_s2_full" + }, + "action_type": "TagDatasetAction", + "output_name": "busco_table" + }, + "TagDatasetActionsummary_image": { + "action_arguments": { + "tags": "busco_s2_img" + }, + "action_type": "TagDatasetAction", + "output_name": "summary_image" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.3.2+galaxy0", + "tool_shed_repository": { + "changeset_revision": "41030a6c03b7", + "name": "busco", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"evalue\": \"0.001\", \"limit\": \"3\"}, \"busco_mode\": {\"mode\": \"geno\", \"__current_case__\": 0, \"use_augustus\": {\"use_augustus_selector\": \"no\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage\": {\"lineage_mode\": \"select_lineage\", \"__current_case__\": 1, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}}, \"outputs\": [\"short_summary\", \"missing\", \"image\"], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "5.3.2+galaxy0", + "type": "tool", + "uuid": "9e1fe0cc-77a8-4239-a139-14900a5fcc94", + "when": null, + "workflow_outputs": [ + { + "label": "Busco Summary image", + "output_name": "summary_image", + "uuid": "5e1fe01a-5d84-4deb-a30b-c2a2d4b46b61" + }, + { + "label": "Busco Summary", + "output_name": "busco_sum", + "uuid": "b9937b4e-aed2-4fcf-aad2-1b56d65bed84" + } + ] + }, + "24": { + "annotation": "", + "id": 24, + "input_connections": { + "gfa_stats": { + "id": 20, + "input_subworkflow_step_id": 0, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "gfastats_data_prep", + "outputs": [], + "position": { + "left": 4311.051749745586, + "top": 1677.609375 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "gfastats_data_prep", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "gfa_stats" + } + ], + "label": "gfa_stats", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.0, + "top": 189.90056800842285 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": \"\"}", + "tool_version": null, + "type": "data_input", + "uuid": "fdbf6b66-a9af-446d-bcfc-751cced346cd", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "sort1", + "errors": null, + "id": 1, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 302.6136245727539, + "top": 0.0 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "sort1", + "tool_state": "{\"column\": \"2\", \"column_set\": [], \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"order\": \"DESC\", \"style\": \"num\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "f1b3bcb0-fdcb-4371-b290-fddd744ea5f5", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 1, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 292.1306838989258, + "top": 235.1562442779541 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"{total += $2; $3 = total}1\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "dbb92d28-6ffc-446d-8c9e-af5b050312e0", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "in_file": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Datamash", + "outputs": [ + { + "name": "out_file", + "type": "input" + } + ], + "position": { + "left": 595.0994338989258, + "top": 116.0227222442627 + }, + "post_job_actions": { + "HideDatasetActionout_file": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.1.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "746e8e4bf929", + "name": "datamash_ops", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"grouping\": \"\", \"header_in\": false, \"header_out\": false, \"ignore_case\": false, \"in_file\": {\"__class__\": \"ConnectedValue\"}, \"narm\": false, \"need_sort\": false, \"operations\": [{\"__index__\": 0, \"op_name\": \"absmax\", \"op_column\": \"3\"}], \"print_full_line\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.0+galaxy2", + "type": "tool", + "uuid": "b1ee0d01-e74a-4d7a-93c1-98c2b2df51e0", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "addValue", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 479.0482864379883, + "top": 456.17896461486816 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "addValue", + "tool_state": "{\"exp\": \"1\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"yes\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.0", + "type": "tool", + "uuid": "6ec1a5cb-d2c5-4e83-a9cb-e6d0c848e65a", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 5, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 693.4658889770508, + "top": 299.4318027496338 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "b11a26ab-1b2a-431d-9300-149d64a6fd4b", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 6, + "input_connections": { + "components_1|param_type|component_value": { + "id": 5, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": null, + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 885.0994338989258, + "top": 493.36646461486816 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"c3/\"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"integer\", \"__current_case__\": 1, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.1", + "type": "tool", + "uuid": "b33c8190-2050-4cb2-952b-14b6fb743871", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "errors": null, + "id": 7, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "ops|expressions_0|cond": { + "id": 6, + "output_name": "out1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Compute", + "name": "input" + } + ], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1115.0993728637695, + "top": 735.5255222320557 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "gfastats data for plotting" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.0", + "tool_shed_repository": { + "changeset_revision": "6595517c2dd8", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"RuntimeValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": {\"__class__\": \"ConnectedValue\"}, \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 1, \"cond\": \"c2/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}, {\"__index__\": 2, \"cond\": \"c3/1000000\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.0", + "type": "tool", + "uuid": "c0c0c727-dd65-4c49-8a11-d9a478e6c12a", + "when": null, + "workflow_outputs": [ + { + "label": "gfastats data for plotting", + "output_name": "out_file1", + "uuid": "d246b00a-6e3b-4523-995c-04bfbf58a684" + } + ] + } + }, + "tags": "", + "uuid": "b17bb747-7951-441b-86be-2bd3175d9ecf" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "83f9b620-0516-4c3f-b6fe-0897a8852440", + "when": null, + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", + "errors": null, + "id": 25, + "input_connections": { + "forward": { + "id": 21, + "output_name": "bam_output" + }, + "reverse": { + "id": 22, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Filter and merge", + "outputs": [ + { + "name": "outfile", + "type": "bam" + } + ], + "position": { + "left": 3740.7236247455858, + "top": 827.390625 + }, + "post_job_actions": { + "TagDatasetActionoutfile": { + "action_arguments": { + "tags": "merged_alignments_s2" + }, + "action_type": "TagDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bellerophon/bellerophon/1.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "25ca5d73aedf", + "name": "bellerophon", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__job_resource__select\": \"no\", \"__current_case__\": 0}, \"forward\": {\"__class__\": \"ConnectedValue\"}, \"quality\": \"20\", \"reverse\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0+galaxy0", + "type": "tool", + "uuid": "ba91283e-b942-44b4-89f3-acae2c64a614", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 26, + "input_connections": { + "input": { + "id": 24, + "output_name": "gfastats data for plotting" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 4874.457999745586, + "top": 1404.421875 + }, + "post_job_actions": {}, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c5,c6\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "b6dad0fb-da2c-4834-bd1e-d50f93397d56", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 27, + "input_connections": { + "input": { + "id": 24, + "output_name": "gfastats data for plotting" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 4876.489249745586, + "top": 1545.40625 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c4,c7\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.2", + "type": "tool", + "uuid": "857e88d4-43fb-4b2a-87fc-5beb5e5ae360", + "when": null, + "workflow_outputs": [] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", + "errors": null, + "id": 28, + "input_connections": { + "input": { + "id": 25, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4079.5829997455858, + "top": 961.375 + }, + "post_job_actions": { + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "pretextmap_s2, #s2" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.1.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "dfb8a4497339", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": null, \"sorting\": {\"sortby\": \"nosort\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.1.9+galaxy0", + "type": "tool", + "uuid": "2eebc19f-da4f-4ec2-8030-81f81cc38fdf", + "when": null, + "workflow_outputs": [] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", + "errors": null, + "id": 29, + "input_connections": { + "input": { + "id": 25, + "output_name": "outfile" + } + }, + "inputs": [], + "label": null, + "name": "bedtools BAM to BED", + "outputs": [ + { + "name": "output", + "type": "bed" + } + ], + "position": { + "left": 4221.770499745586, + "top": 721.03125 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_bamtobed/2.30.0+galaxy2", + "tool_shed_repository": { + "changeset_revision": "a1a923cd89e8", + "name": "bedtools", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__job_resource\": {\"__current_case__\": 0, \"__job_resource__select\": \"no\"}, \"ed_score\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"option\": \"-bed12\", \"split\": false, \"tag\": \"\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "2.30.0+galaxy2", + "type": "tool", + "uuid": "7afcb308-39dd-4a22-b787-c751952777d4", + "when": null, + "workflow_outputs": [] + }, + "30": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 30, + "input_connections": { + "input1": { + "id": 26, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Nx Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 5153.832999745586, + "top": 1327.078125 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Nx Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#nx_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Default\", \"__current_case__\": 0}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"x\", \"xplot\": \"1\", \"ylab\": \"Nx (Mb)\", \"yplot\": \"2\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "a544c06c-ce84-4764-86a5-64156da53e70", + "when": null, + "workflow_outputs": [ + { + "label": "Nx Plot", + "output_name": "output1", + "uuid": "9228733c-40da-48e7-94ec-a0477bb350c5" + } + ] + }, + "31": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "errors": null, + "id": 31, + "input_connections": { + "input1": { + "id": 27, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Size Plot", + "name": "Scatterplot with ggplot2", + "outputs": [ + { + "name": "output1", + "type": "png" + } + ], + "position": { + "left": 5145.551749745586, + "top": 1561.296875 + }, + "post_job_actions": { + "RenameDatasetActionoutput1": { + "action_arguments": { + "newname": "Size Plot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output1" + }, + "TagDatasetActionoutput1": { + "action_arguments": { + "tags": "#size_plot" + }, + "action_type": "TagDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/ggplot2_point/ggplot2_point/3.4.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "5fe1dc76176e", + "name": "ggplot2_point", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv\": {\"type_conditional\": {\"type_options\": \"lines\", \"__current_case__\": 2}, \"factor\": {\"factoring\": \"Default\", \"__current_case__\": 0}, \"axis_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"axis_text_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"plot_title_customization\": {\"axis_customization\": \"default\", \"__current_case__\": 0}, \"gridlinecust\": \"default\", \"transform\": \"none\", \"scaling\": {\"plot_scaling\": \"Automatic\", \"__current_case__\": 0}, \"theme\": \"bw\", \"legend\": \"yes\"}, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"out\": {\"unit_output_dim\": \"in\", \"width_output_dim\": \"6.0\", \"height_output_dim\": \"4.0\", \"dpi_output_dim\": \"300.0\", \"additional_output_format\": \"none\"}, \"title\": \"\", \"xlab\": \"Scaffold number\", \"xplot\": \"1\", \"ylab\": \"Cumulative Size (Mb)\", \"yplot\": \"2\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "3.4.0+galaxy0", + "type": "tool", + "uuid": "4debf869-faae-49f1-8668-d9adcae2d92f", + "when": null, + "workflow_outputs": [ + { + "label": "Size Plot", + "output_name": "output1", + "uuid": "e4070c52-a085-40f6-9ea0-1098738d7bba" + } + ] + }, + "32": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", + "errors": null, + "id": 32, + "input_connections": { + "input": { + "id": 28, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 4447.950301082095, + "top": 1064.8994221213547 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + }, + "TagDatasetActionpretext_snap_out": { + "action_arguments": { + "tags": "pretext_s2" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "44c66e8d21e6", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"5\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": true, \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"1000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "0.0.3+galaxy1", + "type": "tool", + "uuid": "6e14e43c-ac36-499c-bf33-c513edd7445d", + "when": null, + "workflow_outputs": [] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/1.1.1", + "errors": null, + "id": 33, + "input_connections": { + "infile": { + "id": 29, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Sort", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 4535.075132770334, + "top": 390.1009386788954 + }, + "post_job_actions": { + "TagDatasetActionoutfile": { + "action_arguments": { + "tags": "sorted_merged_alignments_s2" + }, + "action_type": "TagDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sort_header_tool/1.1.1", + "tool_shed_repository": { + "changeset_revision": "ddf54b12c295", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"header\": \"0\", \"ignore_case\": false, \"infile\": {\"__class__\": \"ConnectedValue\"}, \"sortkeys\": [{\"__index__\": 0, \"column\": \"4\", \"order\": \"\", \"style\": \"\"}], \"unique\": false, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.1.1", + "type": "tool", + "uuid": "1a3de58d-2ff9-48f1-a1d6-fab5d28f0b0b", + "when": null, + "workflow_outputs": [] + }, + "34": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 34, + "input_connections": { + "input": { + "id": 32, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 4712.270499745586, + "top": 1125.96875 + }, + "post_job_actions": { + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_s2" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_version": "1.0.1", + "type": "tool", + "uuid": "df9dfd34-8b01-4146-b2c4-3e5bfef08121", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Map After HiC scaffolding", + "output_name": "output", + "uuid": "c4d0b6de-445f-4e23-9ddd-04f3f54712da" + } + ] + } + }, + "tags": [ + "VGP_curated" + ], + "uuid": "2551cf72-6739-4ff1-a5ac-8f5061121fda", + "version": 3 +}