diff --git a/KBDEV_1086.py b/KBDEV_1086.py
new file mode 100644
index 0000000..791ef82
--- /dev/null
+++ b/KBDEV_1086.py
@@ -0,0 +1,37 @@
+from graphkb.vocab import (
+ get_equivalent_terms, # similar terms or parents
+ get_term_by_name, # return 1 vocab record
+ get_term_tree, # similar terms, parents or children
+ get_terms_set, # similar terms or children? Only RIDs
+)
+from script_conn import connection
+
+# CONNECTION
+##############################################################
+env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# INITIAL DATA
+##############################################################
+name = 'copy variant'
+
+# QUERY
+##############################################################
+termTree = get_term_tree(conn, name)
+equiTerms = get_equivalent_terms(conn, name)
+termsSet = get_terms_set(conn, name)
+terms = get_term_by_name(conn, name)
+
+# LOGGING
+##############################################################
+for term in termTree:
+ print(term)
+print()
+for term in equiTerms:
+ print(term)
+print()
+for term in termsSet:
+ print(term)
+print()
+print(terms)
+
diff --git a/cancer_genes.txt b/cancer_genes.txt
new file mode 100644
index 0000000..ec67744
--- /dev/null
+++ b/cancer_genes.txt
@@ -0,0 +1,507 @@
+cancer genes (506) :
+ABI1
+ACKR3
+ACSL3
+ACSL6
+ACTB
+ACVR1B
+ACVR2A
+ADGRA2
+AFDN
+AFF1
+AFF3
+AGO2
+ALB
+ANKRD26
+APH1A
+APOBEC3B
+ARFRP1
+ARHGAP26
+ARHGEF12
+ARID3C
+ARID5A
+ARNT
+ASMTL
+ASPSCR1
+ATG5
+ATIC
+ATP2B3
+ATP6AP1
+BABAM1
+BAX
+BCL11A
+BCL2L1
+BCL2L2
+BCL7A
+BCL9L
+BIRC3
+BTLA
+BUB1B
+CACNA1D
+CAD
+CAMTA1
+CANT1
+CARM1
+CARS1
+CBFA2T3
+CBLB
+CBLC
+CCDC6
+CCN6
+CCNB1IP1
+CCT6B
+CD22
+CD36
+CD70
+CD74
+CDH11
+CDX2
+CENPA
+CEP43
+CHCHD7
+CHD2
+CHD4
+CHIC2
+CHN1
+CILK1
+CKS1B
+CLIP1
+CLP1
+CLTC
+CLTCL1
+CNBP
+CNOT3
+CNTRL
+COL1A1
+COL2A1
+CPS1
+CREB3L1
+CREB3L2
+CRTC1
+CRTC3
+CSDE1
+CSF1
+CSF1R
+CSNK1A1
+CTNNA1
+CUL4A
+CYP17A1
+DAZAP1
+DCTN1
+DDB2
+DDIT3
+DDR1
+DDX10
+DDX5
+DDX6
+DHX15
+DKK1
+DKK2
+DKK3
+DKK4
+DNAJB1
+DNM2
+DROSHA
+DUSP2
+DUSP9
+EBF1
+EIF1AX
+EIF3E
+ELF4
+ELK4
+ELL
+ELN
+ELOC
+ELP2
+EML4
+EMSY
+EPAS1
+EPHA5
+EPHB4
+EPS15
+ERC1
+ERCC1
+ETNK1
+ETS1
+EXOSC6
+EXT2
+EZR
+FAF1
+FANCE
+FANCF
+FANCG
+FANCI
+FAT4
+FBXO31
+FBXW2
+FCGR2B
+FCRL4
+FES
+FEV
+FGF1
+FGF10
+FGF12
+FGF14
+FGF2
+FGF23
+FGF5
+FGF6
+FGF7
+FGF8
+FGF9
+FHIT
+FIP1L1
+FLYWCH1
+FNBP1
+FOXO3
+FOXO4
+FRS2
+FSTL3
+GABRA6
+GADD45B
+GAS7
+GATA1
+GATA4
+GATA6
+GEN1
+GID4
+GMPS
+GOLGA5
+GOPC
+GPC3
+GPHN
+GRM3
+GTSE1
+H1-2
+H2AC11
+H2AC16
+H2AC6
+H2BC11
+H2BC12
+H2BC17
+H2BC4
+H2BC5
+H2BC8
+H3-3B
+H3-4
+H3-5
+H3C1
+H3C10
+H3C11
+H3C12
+H3C13
+H3C14
+H3C15
+H3C2
+H3C3
+H3C4
+H3C6
+H3C7
+H3C8
+H3P6
+H4C9
+HERPUD1
+HEY1
+HIP1
+HIRA
+HLF
+HNRNPA2B1
+HNRNPK
+HOOK3
+HOXA11
+HOXA13
+HOXA3
+HOXA9
+HOXC11
+HOXC13
+HOXD11
+HOXD13
+HSD3B1
+HSP90AA1
+HSP90AB1
+IGH
+IGK
+IGL
+IKBKB
+IKZF1
+IKZF2
+IL10
+IL2
+IL21R
+INPP4A
+INPP5D
+IRF2
+IRS4
+ITK
+JAZF1
+KAT6A
+KAT6B
+KBTBD4
+KCNJ5
+KDM2B
+KDM4C
+KDSR
+KEL
+KIF5B
+KLF6
+KLHL6
+KLK2
+KMT5A
+KNL1
+KNSTRN
+KTN1
+LAMP1
+LARP4B
+LASP1
+LCP1
+LEF1
+LIFR
+LMNA
+LPP
+LRIG3
+LRP1B
+LRRK2
+LYL1
+MAF
+MAGED1
+MAGI2
+MALT1
+MAML2
+MAP3K4
+MAP3K6
+MAP3K7
+MAPKAP1
+MDC1
+MDS2
+MEF2C
+MERTK
+MIB1
+MKNK1
+MLF1
+MLLT1
+MLLT11
+MLLT6
+MN1
+MNX1
+MPEG1
+MRTFA
+MSN
+MTCP1
+MUC1
+MYB
+MYH9
+MYO18A
+MYO5A
+NAB2
+NACA
+NBEAP1
+NCOA1
+NCOA2
+NCOA4
+NCOR2
+NDRG1
+NEGR1
+NFATC2
+NFIB
+NFKB2
+NFKBIE
+NIN
+NOD1
+NONO
+NSD3
+NUMA1
+NUP93
+NUTM1
+NUTM2A
+NUTM2B
+OLIG2
+OMD
+PAFAH1B2
+PAG1
+PAK3
+PARP2
+PARP3
+PASK
+PATZ1
+PAX3
+PAX7
+PBX1
+PC
+PCBP1
+PCLO
+PCM1
+PCSK7
+PDCD11
+PDE4DIP
+PDK1
+PDPK1
+PER1
+PHF1
+PICALM
+PIK3C2B
+PIK3C2G
+PIK3C3
+PIM1
+PLAG1
+PLK2
+PML
+PNRC1
+POLG
+POLQ
+POU2AF1
+POU5F1
+PPFIBP1
+PPP1CB
+PPP4R2
+PRCC
+PRDM14
+PRDM16
+PREX2
+PRF1
+PRKAR1A
+PRKD1
+PRKDC
+PRRX1
+PRSS1
+PRSS8
+PSIP1
+PTK6
+PTK7
+PTP4A1
+PTPN13
+PTPN6
+PTPRB
+PTPRC
+PTPRK
+PTPRO
+PUM1
+QKI
+RABEP1
+RAD52
+RAD54L
+RALGDS
+RANBP2
+RAP1GDS1
+RARA
+RASGEF1A
+RELN
+RHOH
+RMI2
+RNF213
+RNF217-AS1
+RPL10
+RPL22
+RPL5
+RPN1
+RPS6KB1
+RSPO2
+RSPO3
+RUNX2
+RXRA
+S1PR2
+SALL4
+SBDS
+SDC4
+SEC31A
+SEPTIN5
+SEPTIN6
+SEPTIN9
+SERP2
+SERPINB4
+SETD1B
+SETD3
+SETD4
+SETD5
+SETD6
+SETD7
+SFPQ
+SFRP4
+SH3GL1
+SIX1
+SLC1A2
+SLC34A2
+SLC45A3
+SLIT2
+SMARCA1
+SMARCD1
+SNCAIP
+SND1
+SNX29
+SOCS2
+SOX10
+SPTA1
+SRSF2
+SRSF3
+SS18L1
+SSX1
+SSX2
+SSX4
+STAT1
+STAT2
+STAT4
+STIL
+STK40
+STRN
+TAF1
+TAF15
+TAL2
+TAP1
+TAP2
+TCEA1
+TCF12
+TEC
+TEK
+TERC
+TFEB
+TFG
+TFPT
+TFRC
+TIPARP
+TLE1
+TLE2
+TLE3
+TLE4
+TLL2
+TMEM30A
+TMPRSS2
+TMSB4XP8
+TNFRSF11A
+TNFRSF17
+TOP2A
+TPM3
+TPM4
+TPR
+TRAF2
+TRAF7
+TRIM24
+TRIM33
+TRIP11
+TRRAP
+TTL
+TUSC3
+TYRO3
+U2AF2
+UPF1
+USP6
+VTCN1
+WAS
+WDCP
+WDR90
+WRN
+XPA
+XPC
+YPEL5
+YWHAE
+YY1AP1
+ZBTB16
+ZBTB2
+ZBTB7A
+ZMYM2
+ZMYM3
+ZNF217
+ZNF24
+ZNF331
+ZNF384
+ZNF521
+ZNF703
+ZRSR2
diff --git a/data_2.py b/data_2.py
new file mode 100644
index 0000000..721a65b
--- /dev/null
+++ b/data_2.py
@@ -0,0 +1,174 @@
+"""_summary_
+ matches:
+ Array of variant (diplayName and type) that MUST be matching, but not restricted to
+ does_not_matches:
+ Array of variant (diplayName and type) that MUST NOT be matching, but not restricted to
+"""
+
+KBDEV_1024 = {
+ "TSC2:c.3365G>C": {
+ "matches": {
+ "displayName": [""],
+ "type": [""],
+ },
+ "does_not_matches": {
+ "displayName": [""],
+ "type": [""],
+ },
+ },
+}
+
+KBDEV_1044 = {
+ "TSC2:c.4700G>A": {
+ "matches": {
+ "displayName": [
+ "ENST00000219476:c.4700G>A",
+ "ENST00000219476:r.4810G>A",
+ "TSC2 mutation",
+ "TSC2:p.G1567D",
+ "chr16:g.2086230G>A",
+ ],
+ "type": [
+ "missense mutation",
+ "mutation",
+ "substitution",
+ ],
+ },
+ "does_not_matches": {
+ "displayName": [
+ "TSC2 nonsense",
+ ],
+ "type": [
+ "nonsense",
+ ],
+ },
+ },
+}
+
+
+
+OTHERS = {
+ "KRAS:p.G12D": {
+ "matches": {
+ "displayName": [
+ "ENST00000256078:r.225_226delinsAC",
+ "ENST00000311936.7:c.35G>A",
+ "KRAS mutation",
+ "KRAS:c.35G>A",
+ "KRAS:p.(G12_G13)mut",
+ "KRAS:p.?12mut",
+ "KRAS:p.G12",
+ "KRAS:p.G12D",
+ "KRAS:p.G12X",
+ "KRAS:p.G12mut",
+ ],
+ "type": [
+ "indel",
+ "missense",
+ "missense mutation",
+ "mutation",
+ "substitution",
+ ],
+ },
+ "does_not_matches": {
+ "displayName": [
+ "chr12:g.25245349_25245351delinsGCT",
+ "cosm516",
+ "ensp00000452512:p.G12V",
+ ],
+ "type": [
+ "nonsense",
+ ],
+ },
+ },
+}
+
+GERO_299 = {
+ "TP53:p.M237I": {
+ "matches": {
+ "displayName": [
+ "ENST00000269305:r.901G>T",
+ "TP53 missense",
+ "TP53 mutation",
+ "TP53:p.M237I",
+ "TP53:p.M237X",
+ "chr17:g.7577570C>T",
+ ],
+ "type": [
+ "missense",
+ "missense mutation",
+ "mutation",
+ "substitution",
+ ],
+ },
+ "does_not_matches": {
+ "displayName": [
+ "TP53 nonsense",
+ ],
+ "type": [
+ "nonsense",
+ ],
+ },
+ },
+}
+
+
+# Testing combinations
+x = dict(
+ **KBDEV_1024,
+ **KBDEV_1044,
+)
+
+########################
+## KBDEV-1038
+########################
+# "FGFR4:p.N535K",
+# "EGFR:p.D942N",
+########################
+## KBDEV-1052
+########################
+# "EGFR:c.28246G>A",
+# "chr7:g.55198839G>A",
+# "EGFR:p.D942N",
+# '(PCM1,JAK2):fusion(r.6280,r.1821)', # dummy test for Infers edges
+########################
+## KBDEV-1054
+########################
+# "ERBB2:p.R814C",
+########################
+## KBDEV-1056
+########################
+"FGFR3:c.1212dupC",
+"FGFR3:c.1212dupACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
+"FGFR3:c.1212_1213insC",
+"FGFR3:c.1212C>A",
+"chr1:g.33344590_33344592del",
+"FGFR3:g.5000_5001del",
+"FGFR3:g.5000_5100del",
+"FGFR3:c.9002_9050delinsTTT",
+"FGFR3:c.9002_9051delinsTTT",
+########################
+## GERO-299
+########################
+# "chr17:g.7674252C>T",
+# "ENST00000269305:c.711G>A",
+# "TP53:p.M237I",
+########################
+## KBDEV-1024
+########################
+# "TSC2:c.3365G>C",
+# "NM_000548.5:c.3365G>A",
+# "NM_000548.5:p.Arg1122His",
+# "TSC2: p.R112H",
+########################
+## KBDEV-1044
+########################
+# "TSC2:c.4700G>A",
+########################
+## OTHER Ex.
+########################
+# "ENST00000219476:c.4700_4701delinsAT",
+# "NM_000548.5:c.3365G>A",
+# "TSC2:p.R112H",
+# "TSC2:p.G1567D",
+# "KRAS:p.G12D",
diff --git a/data_3.json b/data_3.json
new file mode 100644
index 0000000..47de5fe
--- /dev/null
+++ b/data_3.json
@@ -0,0 +1,161 @@
+{
+ "TSC2:c.3365G>C": {
+ "comment": "KBDEV-1024",
+ "matches": {
+ "displayName": [
+ ""
+ ],
+ "type": [
+ ""
+ ]
+ },
+ "does_not_matches":{
+ "displayName": [
+ ""
+ ],
+ "type": [
+ ""
+ ]
+ }
+ },
+ "TSC2:c.4700G>A": {
+ "comment": "",
+ "matches": {
+ "displayName": [
+ "ENST00000219476:c.4700G>A",
+ "ENST00000219476:r.4810G>A",
+ "TSC2 mutation",
+ "TSC2:p.G1567D",
+ "chr16:g.2086230G>A"
+ ],
+ "type": [
+ "missense mutation",
+ "mutation",
+ "substitution"
+ ]
+ },
+ "does_not_matches":{
+ "displayName": [
+ "TSC2 nonsense"
+ ],
+ "type": [
+ "nonsense"
+ ]
+ }
+ },
+ "KRAS:p.G12D": {
+ "comment": "",
+ "matches": {
+ "displayName": [
+ "ENST00000256078:r.225_226delinsAC",
+ "ENST00000311936.7:c.35G>A",
+ "KRAS mutation",
+ "KRAS:c.35G>A",
+ "KRAS:p.(G12_G13)mut",
+ "KRAS:p.?12mut",
+ "KRAS:p.G12",
+ "KRAS:p.G12D",
+ "KRAS:p.G12X",
+ "KRAS:p.G12mut"
+ ],
+ "type": [
+ "indel",
+ "missense",
+ "missense mutation",
+ "mutation",
+ "substitution"
+ ]
+ },
+ "does_not_matches":{
+ "displayName": [
+ "chr12:g.25245349_25245351delinsGCT",
+ "cosm516",
+ "ensp00000452512:p.G12V"
+ ],
+ "type": [
+ "nonsense"
+ ]
+ }
+ },
+ "TP53:p.M237I": {
+ "comment": "GERO-299",
+ "matches": {
+ "displayName": [
+ "ENST00000269305:r.901G>T",
+ "TP53 missense",
+ "TP53 mutation",
+ "TP53:p.M237I",
+ "TP53:p.M237X",
+ "chr17:g.7577570C>T"
+ ],
+ "type": [
+ "missense",
+ "missense mutation",
+ "mutation",
+ "substitution"
+ ]
+ },
+ "does_not_matches":{
+ "displayName": [
+ "TP53 nonsense"
+ ],
+ "type": [
+ "nonsense"
+ ]
+ }
+ }
+}
+
+########################
+## KBDEV-1038
+########################
+# "FGFR4:p.N535K",
+# "EGFR:p.D942N",
+########################
+## KBDEV-1052
+########################
+# "EGFR:c.28246G>A",
+# "chr7:g.55198839G>A",
+# "EGFR:p.D942N",
+# '(PCM1,JAK2):fusion(r.6280,r.1821)', # dummy test for Infers edges
+########################
+## KBDEV-1054
+########################
+# "ERBB2:p.R814C",
+########################
+## KBDEV-1056
+########################
+"ENST00000340107:c.1212dupC",
+"ENST00000340107:c.1212dupACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
+"ENST00000340107:c.1212_1213insC",
+"ENST00000340107:c.1212C>A",
+"chr1:g.33344590_33344592del",
+"FGFR3:g.5000_5001del",
+"FGFR3:g.5000_5100del",
+"ENST00000340107:c.9002_9050delinsTTT",
+"ENST00000340107:c.9002_9051delinsTTT",
+########################
+## GERO-299
+########################
+# "chr17:g.7674252C>T",
+# "ENST00000269305:c.711G>A",
+# "TP53:p.M237I",
+########################
+## KBDEV-1024
+########################
+# "TSC2:c.3365G>C",
+# "NM_000548.5:c.3365G>A",
+# "NM_000548.5:p.Arg1122His",
+# "TSC2: p.R112H",
+########################
+## KBDEV-1044
+########################
+# "TSC2:c.4700G>A",
+########################
+## OTHER Ex.
+########################
+# "ENST00000219476:c.4700_4701delinsAT",
+# "NM_000548.5:c.3365G>A",
+# "TSC2:p.R112H",
+# "TSC2:p.G1567D",
+# "KRAS:p.G12D",
diff --git a/displayStatement.js b/displayStatement.js
new file mode 100644
index 0000000..2edd9f6
--- /dev/null
+++ b/displayStatement.js
@@ -0,0 +1,24 @@
+const { schema, sentenceTemplates } = require('@bcgsc-pori/graphkb-schema');
+
+const previewFunction = (obj) => schema.getPreview(obj);
+
+// const statement = {
+// displayName: 'displayName',
+// '@class': 'Statement',
+// '@rid': '22:0',
+// displayNameTemplate: 'Given {conditions} {relevance} applies to {subject} ({evidence})',
+// relevance: { displayName: 'Mood Swings', '@rid': '1' },
+// conditions: [{ displayName: 'Low blood sugar', '@class': 'Disease', '@rid': '2' }],
+// subject: { displayName: 'hungertitis', '@rid': '3', '@class': 'Disease' },
+// evidence: [{ displayName: 'A reputable source', '@rid': '4' }],
+// };
+
+console.log('################################')
+console.log(process.argv[2])
+const statement = JSON.parse(process.argv[2])
+
+const { content } = sentenceTemplates.generateStatementSentence(previewFunction, statement);
+// Given Low blood sugar Mood Swings applies to hungertitis (A reputable source)
+
+statementLabel = schema.getPreview(content);
+console.log(statementLabel)
\ No newline at end of file
diff --git a/genes.txt b/genes.txt
new file mode 100644
index 0000000..165eee8
--- /dev/null
+++ b/genes.txt
@@ -0,0 +1,56 @@
+AKT1
+APC
+ATM
+AXIN2
+BAP1
+BLM
+BMPR1A
+BRCA1
+BRCA2
+BRIP1
+CBL
+CDH1
+CDK4
+CDKN2A
+CHEK2
+DICER1
+EGFR
+EPCAM
+ETV6
+EZH2
+FH
+FLCN
+GATA2
+HRAS
+KIT
+MEN1
+MET
+MLH1
+MSH2
+MSH6
+MUTYH
+NBN
+NF1
+PALB2
+PDGFRA
+PMS2
+PTCH1
+PTEN
+PTPN11
+RAD51C
+RAD51D
+RB1
+RET
+RUNX1
+SDHA
+SDHB
+SDHC
+SDHD
+SMAD4
+SMARCA4
+STK11
+TP53
+TSC1
+TSC2
+VHL
+WT1
diff --git a/graphkb/match.py b/graphkb/match.py
index eea1b1b..46f5a62 100644
--- a/graphkb/match.py
+++ b/graphkb/match.py
@@ -532,7 +532,7 @@ def structural_type_adjustment(
return variant_types_details
-def category_variant_similarTo(
+def category_variant_extension(
conn: GraphKBConnection,
features: List[str],
variant_types_details: Iterable[Record],
@@ -575,6 +575,7 @@ def category_variant_similarTo(
{"reference2": secondary_features},
]
},
+ "returnProperties": VARIANT_RETURN_PROPERTIES,
},
ignore_cache=ignore_cache,
)
@@ -833,7 +834,7 @@ def match_positional_variant(
# e.g. "BRAF:c...del" MATCHING "BRAF deletion"
# e.g. "(BRAF,AKAP9):fusion(...)" MATCHING "BRAF and AKAP9 fusion"
matches.extend(
- category_variant_similarTo(
+ category_variant_extension(
conn,
features,
variant_types_details,
@@ -847,7 +848,7 @@ def match_positional_variant(
# a) matching on inverted reference1 and reference2
# e.g. "(BRAF,AKAP9):fusion(...)" MATCHING "AKAP9 and BRAF fusion"
matches.extend(
- category_variant_similarTo(
+ category_variant_extension(
conn,
features = secondary_features,
variant_types_details = variant_types_details,
@@ -858,7 +859,7 @@ def match_positional_variant(
# b) matching on reference1 = primary features, without reference2
# e.g. "(BRAF,AKAP9):fusion(...)" MATCHING "BRAF fusion"
matches.extend(
- category_variant_similarTo(
+ category_variant_extension(
conn,
features,
variant_types_details,
@@ -869,7 +870,7 @@ def match_positional_variant(
# c) matching on reference1 = secondary features, without reference2
# e.g. "(BRAF,AKAP9):fusion(...)" MATCHING "AKAP9 fusion"
matches.extend(
- category_variant_similarTo(
+ category_variant_extension(
conn,
features = secondary_features,
variant_types_details = variant_types_details,
diff --git a/output.txt b/output.txt
new file mode 100644
index 0000000..c38b538
--- /dev/null
+++ b/output.txt
@@ -0,0 +1,1309 @@
+797 VS 492 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 491 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 546 & None
+ ->False
+797 VS 733 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 464 & None
+ ->False
+797 VS 467 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 734 & None
+ ->False
+797 VS 797 & None
+ ->True
+797 VS 761 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 796 & None
+ ->False
+797 VS 797 & None
+ ->True
+797 VS 858 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 810 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 465 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 724 & None
+ ->False
+797 VS 792 & None
+ ->False
+797 VS 690 & None
+ ->False
+797 VS 742 & None
+ ->False
+797 VS 750 & None
+ ->False
+797 VS 718 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 796 & None
+ ->False
+797 VS 752 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 263 & None
+ ->False
+797 VS 843 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 731 & None
+ ->False
+797 VS 749 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 451 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 735 & None
+ ->False
+797 VS 753 & None
+ ->False
+797 VS 810 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 796 & None
+ ->False
+797 VS 798 & None
+ ->False
+797 VS 492 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 745 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 792 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 757 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 641 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 767 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 222 & None
+ ->False
+797 VS 198 & None
+ ->False
+797 VS 767 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 6 & None
+ ->False
+797 VS 596 & None
+ ->False
+797 VS 628 & None
+ ->False
+797 VS 797 & None
+ ->True
+797 VS 747 & None
+ ->False
+797 VS 843 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 1041 & None
+ ->False
+797 VS 865 & None
+ ->False
+797 VS 762 & 823
+ ->True
+797 VS 105 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 46 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 870 & None
+ ->False
+797 VS 725 & None
+ ->False
+797 VS 767 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 45 & None
+ ->False
+797 VS 546 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 263 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 767 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 62 & None
+ ->False
+797 VS 735 & None
+ ->False
+797 VS 769 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 620 & None
+ ->False
+797 VS 330 & None
+ ->False
+797 VS 804 & None
+ ->False
+797 VS 835 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 844 & None
+ ->False
+797 VS 848 & None
+ ->False
+797 VS 116 & None
+ ->False
+797 VS 363 & None
+ ->False
+797 VS 757 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 763 & None
+ ->False
+797 VS 263 & None
+ ->False
+797 VS 677 & None
+ ->False
+797 VS 277 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 256 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 931 & None
+ ->False
+797 VS 810 & None
+ ->False
+797 VS 853 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 528 & None
+ ->False
+797 VS 464 & None
+ ->False
+797 VS 148 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 324 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 790 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 508 & None
+ ->False
+797 VS 587 & None
+ ->False
+797 VS 712 & None
+ ->False
+797 VS 857 & None
+ ->False
+797 VS 941 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 771 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 492 & None
+ ->False
+797 VS 159 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 771 & None
+ ->False
+797 VS 330 & None
+ ->False
+797 VS 863 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 767 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 38 & None
+ ->False
+797 VS 776 & None
+ ->False
+797 VS 784 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 745 & None
+ ->False
+797 VS 690 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 767 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 30 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 673 & None
+ ->False
+797 VS 716 & None
+ ->False
+797 VS 753 & None
+ ->False
+797 VS 720 & None
+ ->False
+797 VS 834 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 785 & None
+ ->False
+797 VS 718 & None
+ ->False
+797 VS 792 & None
+ ->False
+797 VS 771 & None
+ ->False
+797 VS 774 & None
+ ->False
+797 VS 847 & None
+ ->False
+797 VS 114 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 797 & None
+ ->True
+797 VS 729 & 761
+ ->False
+797 VS 745 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 191 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 884 & None
+ ->False
+797 VS 796 & None
+ ->False
+797 VS 744 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 178 & None
+ ->False
+797 VS 108 & None
+ ->False
+797 VS 306 & None
+ ->False
+797 VS 854 & None
+ ->False
+797 VS 451 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 289 & None
+ ->False
+797 VS 729 & None
+ ->False
+797 VS 709 & None
+ ->False
+797 VS 798 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 763 & None
+ ->False
+797 VS 263 & None
+ ->False
+797 VS 750 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 588 & None
+ ->False
+797 VS 304 & None
+ ->False
+797 VS 745 & None
+ ->False
+797 VS 747 & None
+ ->False
+797 VS 373 & None
+ ->False
+797 VS 669 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 592 & None
+ ->False
+797 VS 764 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 833 & None
+ ->False
+797 VS 755 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 598 & None
+ ->False
+797 VS 47 & None
+ ->False
+797 VS 754 & None
+ ->False
+797 VS 792 & None
+ ->False
+797 VS 589 & None
+ ->False
+797 VS 768 & None
+ ->False
+797 VS 689 & None
+ ->False
+797 VS 770 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 861 & None
+ ->False
+797 VS 763 & None
+ ->False
+797 VS 858 & None
+ ->False
+797 VS 729 & 761
+ ->False
+797 VS 871 & None
+ ->False
+797 VS 282 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 719 & None
+ ->False
+797 VS 773 & None
+ ->False
+797 VS 841 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 98 & None
+ ->False
+797 VS 363 & None
+ ->False
+797 VS 774 & None
+ ->False
+797 VS 772 & None
+ ->False
+797 VS 745 & None
+ ->False
+797 VS 252 & None
+ ->False
+797 VS 1092 & None
+ ->False
+797 VS 746 & None
+ ->False
+797 VS 745 & None
+ ->False
+797 VS 752 & None
+ ->False
+797 VS 751 & None
+ ->False
+797 VS 761 & None
+ ->False
+797 VS 742 & None
+ ->False
+797 VS 838 & None
+ ->False
+797 VS 868 & None
\ No newline at end of file
diff --git a/package-lock.json b/package-lock.json
new file mode 100644
index 0000000..291cfc6
--- /dev/null
+++ b/package-lock.json
@@ -0,0 +1,142 @@
+{
+ "name": "pori_graphkb_python",
+ "version": "1.0.0",
+ "lockfileVersion": 2,
+ "requires": true,
+ "packages": {
+ "": {
+ "name": "pori_graphkb_python",
+ "version": "1.0.0",
+ "license": "ISC",
+ "dependencies": {
+ "@bcgsc-pori/graphkb-schema": "^4.0.0"
+ }
+ },
+ "node_modules/@bcgsc-pori/graphkb-parser": {
+ "version": "2.1.0",
+ "resolved": "https://registry.npmjs.org/@bcgsc-pori/graphkb-parser/-/graphkb-parser-2.1.0.tgz",
+ "integrity": "sha512-EIVRjRdqJv7RjtvZ+wK3qQDLORPAuKoqFkGUg/pHU3JnpgQMXgeOEHBfuwh6U+P09oY1TQdspS7+vUjpINapBg==",
+ "peer": true,
+ "dependencies": {
+ "json-cycle": "^1.3.0"
+ }
+ },
+ "node_modules/@bcgsc-pori/graphkb-schema": {
+ "version": "4.0.0",
+ "resolved": "https://registry.npmjs.org/@bcgsc-pori/graphkb-schema/-/graphkb-schema-4.0.0.tgz",
+ "integrity": "sha512-RrlUYPY/5PyB/HI854rsG2W2DRRVqfg233zgftIEZlKPDpefizrjOROpoMvb/r4usrGQ2blXvRL8FKlvLEpL7g==",
+ "dependencies": {
+ "lodash.omit": "4.5.0",
+ "typescript": "^4.5.5",
+ "uuid": "3.3.2",
+ "uuid-validate": "0.0.3",
+ "validator": "^13.7.0"
+ },
+ "peerDependencies": {
+ "@bcgsc-pori/graphkb-parser": "^2.0.0"
+ }
+ },
+ "node_modules/json-cycle": {
+ "version": "1.5.0",
+ "resolved": "https://registry.npmjs.org/json-cycle/-/json-cycle-1.5.0.tgz",
+ "integrity": "sha512-GOehvd5PO2FeZ5T4c+RxobeT5a1PiGpF4u9/3+UvrMU4bhnVqzJY7hm39wg8PDCqkU91fWGH8qjWR4bn+wgq9w==",
+ "peer": true,
+ "engines": {
+ "node": ">= 4"
+ }
+ },
+ "node_modules/lodash.omit": {
+ "version": "4.5.0",
+ "resolved": "https://registry.npmjs.org/lodash.omit/-/lodash.omit-4.5.0.tgz",
+ "integrity": "sha512-XeqSp49hNGmlkj2EJlfrQFIzQ6lXdNro9sddtQzcJY8QaoC2GO0DT7xaIokHeyM+mIT0mPMlPvkYzg2xCuHdZg=="
+ },
+ "node_modules/typescript": {
+ "version": "4.9.5",
+ "resolved": "https://registry.npmjs.org/typescript/-/typescript-4.9.5.tgz",
+ "integrity": "sha512-1FXk9E2Hm+QzZQ7z+McJiHL4NW1F2EzMu9Nq9i3zAaGqibafqYwCVU6WyWAuyQRRzOlxou8xZSyXLEN8oKj24g==",
+ "bin": {
+ "tsc": "bin/tsc",
+ "tsserver": "bin/tsserver"
+ },
+ "engines": {
+ "node": ">=4.2.0"
+ }
+ },
+ "node_modules/uuid": {
+ "version": "3.3.2",
+ "resolved": "https://registry.npmjs.org/uuid/-/uuid-3.3.2.tgz",
+ "integrity": "sha512-yXJmeNaw3DnnKAOKJE51sL/ZaYfWJRl1pK9dr19YFCu0ObS231AB1/LbqTKRAQ5kw8A90rA6fr4riOUpTZvQZA==",
+ "deprecated": "Please upgrade to version 7 or higher. Older versions may use Math.random() in certain circumstances, which is known to be problematic. See https://v8.dev/blog/math-random for details.",
+ "bin": {
+ "uuid": "bin/uuid"
+ }
+ },
+ "node_modules/uuid-validate": {
+ "version": "0.0.3",
+ "resolved": "https://registry.npmjs.org/uuid-validate/-/uuid-validate-0.0.3.tgz",
+ "integrity": "sha512-Fykw5U4eZESbq739BeLvEBFRuJODfrlmjx5eJux7W817LjRaq4b7/i4t2zxQmhcX+fAj4nMfRdTzO4tmwLKn0w=="
+ },
+ "node_modules/validator": {
+ "version": "13.11.0",
+ "resolved": "https://registry.npmjs.org/validator/-/validator-13.11.0.tgz",
+ "integrity": "sha512-Ii+sehpSfZy+At5nPdnyMhx78fEoPDkR2XW/zimHEL3MyGJQOCQ7WeP20jPYRz7ZCpcKLB21NxuXHF3bxjStBQ==",
+ "engines": {
+ "node": ">= 0.10"
+ }
+ }
+ },
+ "dependencies": {
+ "@bcgsc-pori/graphkb-parser": {
+ "version": "2.1.0",
+ "resolved": "https://registry.npmjs.org/@bcgsc-pori/graphkb-parser/-/graphkb-parser-2.1.0.tgz",
+ "integrity": "sha512-EIVRjRdqJv7RjtvZ+wK3qQDLORPAuKoqFkGUg/pHU3JnpgQMXgeOEHBfuwh6U+P09oY1TQdspS7+vUjpINapBg==",
+ "peer": true,
+ "requires": {
+ "json-cycle": "^1.3.0"
+ }
+ },
+ "@bcgsc-pori/graphkb-schema": {
+ "version": "4.0.0",
+ "resolved": "https://registry.npmjs.org/@bcgsc-pori/graphkb-schema/-/graphkb-schema-4.0.0.tgz",
+ "integrity": "sha512-RrlUYPY/5PyB/HI854rsG2W2DRRVqfg233zgftIEZlKPDpefizrjOROpoMvb/r4usrGQ2blXvRL8FKlvLEpL7g==",
+ "requires": {
+ "lodash.omit": "4.5.0",
+ "typescript": "^4.5.5",
+ "uuid": "3.3.2",
+ "uuid-validate": "0.0.3",
+ "validator": "^13.7.0"
+ }
+ },
+ "json-cycle": {
+ "version": "1.5.0",
+ "resolved": "https://registry.npmjs.org/json-cycle/-/json-cycle-1.5.0.tgz",
+ "integrity": "sha512-GOehvd5PO2FeZ5T4c+RxobeT5a1PiGpF4u9/3+UvrMU4bhnVqzJY7hm39wg8PDCqkU91fWGH8qjWR4bn+wgq9w==",
+ "peer": true
+ },
+ "lodash.omit": {
+ "version": "4.5.0",
+ "resolved": "https://registry.npmjs.org/lodash.omit/-/lodash.omit-4.5.0.tgz",
+ "integrity": "sha512-XeqSp49hNGmlkj2EJlfrQFIzQ6lXdNro9sddtQzcJY8QaoC2GO0DT7xaIokHeyM+mIT0mPMlPvkYzg2xCuHdZg=="
+ },
+ "typescript": {
+ "version": "4.9.5",
+ "resolved": "https://registry.npmjs.org/typescript/-/typescript-4.9.5.tgz",
+ "integrity": "sha512-1FXk9E2Hm+QzZQ7z+McJiHL4NW1F2EzMu9Nq9i3zAaGqibafqYwCVU6WyWAuyQRRzOlxou8xZSyXLEN8oKj24g=="
+ },
+ "uuid": {
+ "version": "3.3.2",
+ "resolved": "https://registry.npmjs.org/uuid/-/uuid-3.3.2.tgz",
+ "integrity": "sha512-yXJmeNaw3DnnKAOKJE51sL/ZaYfWJRl1pK9dr19YFCu0ObS231AB1/LbqTKRAQ5kw8A90rA6fr4riOUpTZvQZA=="
+ },
+ "uuid-validate": {
+ "version": "0.0.3",
+ "resolved": "https://registry.npmjs.org/uuid-validate/-/uuid-validate-0.0.3.tgz",
+ "integrity": "sha512-Fykw5U4eZESbq739BeLvEBFRuJODfrlmjx5eJux7W817LjRaq4b7/i4t2zxQmhcX+fAj4nMfRdTzO4tmwLKn0w=="
+ },
+ "validator": {
+ "version": "13.11.0",
+ "resolved": "https://registry.npmjs.org/validator/-/validator-13.11.0.tgz",
+ "integrity": "sha512-Ii+sehpSfZy+At5nPdnyMhx78fEoPDkR2XW/zimHEL3MyGJQOCQ7WeP20jPYRz7ZCpcKLB21NxuXHF3bxjStBQ=="
+ }
+ }
+}
diff --git a/package.json b/package.json
new file mode 100644
index 0000000..b8b0e5f
--- /dev/null
+++ b/package.json
@@ -0,0 +1,26 @@
+{
+ "name": "pori_graphkb_python",
+ "version": "1.0.0",
+ "description": " [](https://pypi.org/project/graphkb) [](https://codecov.io/gh/bcgsc/pori_graphkb_python) [](https://pypistats.org/packages/graphkb) [](https://doi.org/10.5281/zenodo.5730523)",
+ "main": "displayStatement.js",
+ "directories": {
+ "doc": "docs",
+ "test": "tests"
+ },
+ "scripts": {
+ "test": "echo \"Error: no test specified\" && exit 1"
+ },
+ "repository": {
+ "type": "git",
+ "url": "git+https://github.com/bcgsc/pori_graphkb_python.git"
+ },
+ "author": "",
+ "license": "ISC",
+ "bugs": {
+ "url": "https://github.com/bcgsc/pori_graphkb_python/issues"
+ },
+ "homepage": "https://github.com/bcgsc/pori_graphkb_python#readme",
+ "dependencies": {
+ "@bcgsc-pori/graphkb-schema": "^4.0.0"
+ }
+}
diff --git a/pip-wheel-metadata/graphkb.dist-info/LICENSE b/pip-wheel-metadata/graphkb.dist-info/LICENSE
new file mode 100644
index 0000000..f288702
--- /dev/null
+++ b/pip-wheel-metadata/graphkb.dist-info/LICENSE
@@ -0,0 +1,674 @@
+ GNU GENERAL PUBLIC LICENSE
+ Version 3, 29 June 2007
+
+ Copyright (C) 2007 Free Software Foundation, Inc.
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+ Preamble
+
+ The GNU General Public License is a free, copyleft license for
+software and other kinds of works.
+
+ The licenses for most software and other practical works are designed
+to take away your freedom to share and change the works. By contrast,
+the GNU General Public License is intended to guarantee your freedom to
+share and change all versions of a program--to make sure it remains free
+software for all its users. We, the Free Software Foundation, use the
+GNU General Public License for most of our software; it applies also to
+any other work released this way by its authors. You can apply it to
+your programs, too.
+
+ When we speak of free software, we are referring to freedom, not
+price. Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+them if you wish), that you receive source code or can get it if you
+want it, that you can change the software or use pieces of it in new
+free programs, and that you know you can do these things.
+
+ To protect your rights, we need to prevent others from denying you
+these rights or asking you to surrender the rights. Therefore, you have
+certain responsibilities if you distribute copies of the software, or if
+you modify it: responsibilities to respect the freedom of others.
+
+ For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must pass on to the recipients the same
+freedoms that you received. You must make sure that they, too, receive
+or can get the source code. And you must show them these terms so they
+know their rights.
+
+ Developers that use the GNU GPL protect your rights with two steps:
+(1) assert copyright on the software, and (2) offer you this License
+giving you legal permission to copy, distribute and/or modify it.
+
+ For the developers' and authors' protection, the GPL clearly explains
+that there is no warranty for this free software. For both users' and
+authors' sake, the GPL requires that modified versions be marked as
+changed, so that their problems will not be attributed erroneously to
+authors of previous versions.
+
+ Some devices are designed to deny users access to install or run
+modified versions of the software inside them, although the manufacturer
+can do so. This is fundamentally incompatible with the aim of
+protecting users' freedom to change the software. The systematic
+pattern of such abuse occurs in the area of products for individuals to
+use, which is precisely where it is most unacceptable. Therefore, we
+have designed this version of the GPL to prohibit the practice for those
+products. If such problems arise substantially in other domains, we
+stand ready to extend this provision to those domains in future versions
+of the GPL, as needed to protect the freedom of users.
+
+ Finally, every program is threatened constantly by software patents.
+States should not allow patents to restrict development and use of
+software on general-purpose computers, but in those that do, we wish to
+avoid the special danger that patents applied to a free program could
+make it effectively proprietary. To prevent this, the GPL assures that
+patents cannot be used to render the program non-free.
+
+ The precise terms and conditions for copying, distribution and
+modification follow.
+
+ TERMS AND CONDITIONS
+
+ 0. Definitions.
+
+ "This License" refers to version 3 of the GNU General Public License.
+
+ "Copyright" also means copyright-like laws that apply to other kinds of
+works, such as semiconductor masks.
+
+ "The Program" refers to any copyrightable work licensed under this
+License. Each licensee is addressed as "you". "Licensees" and
+"recipients" may be individuals or organizations.
+
+ To "modify" a work means to copy from or adapt all or part of the work
+in a fashion requiring copyright permission, other than the making of an
+exact copy. The resulting work is called a "modified version" of the
+earlier work or a work "based on" the earlier work.
+
+ A "covered work" means either the unmodified Program or a work based
+on the Program.
+
+ To "propagate" a work means to do anything with it that, without
+permission, would make you directly or secondarily liable for
+infringement under applicable copyright law, except executing it on a
+computer or modifying a private copy. Propagation includes copying,
+distribution (with or without modification), making available to the
+public, and in some countries other activities as well.
+
+ To "convey" a work means any kind of propagation that enables other
+parties to make or receive copies. Mere interaction with a user through
+a computer network, with no transfer of a copy, is not conveying.
+
+ An interactive user interface displays "Appropriate Legal Notices"
+to the extent that it includes a convenient and prominently visible
+feature that (1) displays an appropriate copyright notice, and (2)
+tells the user that there is no warranty for the work (except to the
+extent that warranties are provided), that licensees may convey the
+work under this License, and how to view a copy of this License. If
+the interface presents a list of user commands or options, such as a
+menu, a prominent item in the list meets this criterion.
+
+ 1. Source Code.
+
+ The "source code" for a work means the preferred form of the work
+for making modifications to it. "Object code" means any non-source
+form of a work.
+
+ A "Standard Interface" means an interface that either is an official
+standard defined by a recognized standards body, or, in the case of
+interfaces specified for a particular programming language, one that
+is widely used among developers working in that language.
+
+ The "System Libraries" of an executable work include anything, other
+than the work as a whole, that (a) is included in the normal form of
+packaging a Major Component, but which is not part of that Major
+Component, and (b) serves only to enable use of the work with that
+Major Component, or to implement a Standard Interface for which an
+implementation is available to the public in source code form. A
+"Major Component", in this context, means a major essential component
+(kernel, window system, and so on) of the specific operating system
+(if any) on which the executable work runs, or a compiler used to
+produce the work, or an object code interpreter used to run it.
+
+ The "Corresponding Source" for a work in object code form means all
+the source code needed to generate, install, and (for an executable
+work) run the object code and to modify the work, including scripts to
+control those activities. However, it does not include the work's
+System Libraries, or general-purpose tools or generally available free
+programs which are used unmodified in performing those activities but
+which are not part of the work. For example, Corresponding Source
+includes interface definition files associated with source files for
+the work, and the source code for shared libraries and dynamically
+linked subprograms that the work is specifically designed to require,
+such as by intimate data communication or control flow between those
+subprograms and other parts of the work.
+
+ The Corresponding Source need not include anything that users
+can regenerate automatically from other parts of the Corresponding
+Source.
+
+ The Corresponding Source for a work in source code form is that
+same work.
+
+ 2. Basic Permissions.
+
+ All rights granted under this License are granted for the term of
+copyright on the Program, and are irrevocable provided the stated
+conditions are met. This License explicitly affirms your unlimited
+permission to run the unmodified Program. The output from running a
+covered work is covered by this License only if the output, given its
+content, constitutes a covered work. This License acknowledges your
+rights of fair use or other equivalent, as provided by copyright law.
+
+ You may make, run and propagate covered works that you do not
+convey, without conditions so long as your license otherwise remains
+in force. You may convey covered works to others for the sole purpose
+of having them make modifications exclusively for you, or provide you
+with facilities for running those works, provided that you comply with
+the terms of this License in conveying all material for which you do
+not control copyright. Those thus making or running the covered works
+for you must do so exclusively on your behalf, under your direction
+and control, on terms that prohibit them from making any copies of
+your copyrighted material outside their relationship with you.
+
+ Conveying under any other circumstances is permitted solely under
+the conditions stated below. Sublicensing is not allowed; section 10
+makes it unnecessary.
+
+ 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
+
+ No covered work shall be deemed part of an effective technological
+measure under any applicable law fulfilling obligations under article
+11 of the WIPO copyright treaty adopted on 20 December 1996, or
+similar laws prohibiting or restricting circumvention of such
+measures.
+
+ When you convey a covered work, you waive any legal power to forbid
+circumvention of technological measures to the extent such circumvention
+is effected by exercising rights under this License with respect to
+the covered work, and you disclaim any intention to limit operation or
+modification of the work as a means of enforcing, against the work's
+users, your or third parties' legal rights to forbid circumvention of
+technological measures.
+
+ 4. Conveying Verbatim Copies.
+
+ You may convey verbatim copies of the Program's source code as you
+receive it, in any medium, provided that you conspicuously and
+appropriately publish on each copy an appropriate copyright notice;
+keep intact all notices stating that this License and any
+non-permissive terms added in accord with section 7 apply to the code;
+keep intact all notices of the absence of any warranty; and give all
+recipients a copy of this License along with the Program.
+
+ You may charge any price or no price for each copy that you convey,
+and you may offer support or warranty protection for a fee.
+
+ 5. Conveying Modified Source Versions.
+
+ You may convey a work based on the Program, or the modifications to
+produce it from the Program, in the form of source code under the
+terms of section 4, provided that you also meet all of these conditions:
+
+ a) The work must carry prominent notices stating that you modified
+ it, and giving a relevant date.
+
+ b) The work must carry prominent notices stating that it is
+ released under this License and any conditions added under section
+ 7. This requirement modifies the requirement in section 4 to
+ "keep intact all notices".
+
+ c) You must license the entire work, as a whole, under this
+ License to anyone who comes into possession of a copy. This
+ License will therefore apply, along with any applicable section 7
+ additional terms, to the whole of the work, and all its parts,
+ regardless of how they are packaged. This License gives no
+ permission to license the work in any other way, but it does not
+ invalidate such permission if you have separately received it.
+
+ d) If the work has interactive user interfaces, each must display
+ Appropriate Legal Notices; however, if the Program has interactive
+ interfaces that do not display Appropriate Legal Notices, your
+ work need not make them do so.
+
+ A compilation of a covered work with other separate and independent
+works, which are not by their nature extensions of the covered work,
+and which are not combined with it such as to form a larger program,
+in or on a volume of a storage or distribution medium, is called an
+"aggregate" if the compilation and its resulting copyright are not
+used to limit the access or legal rights of the compilation's users
+beyond what the individual works permit. Inclusion of a covered work
+in an aggregate does not cause this License to apply to the other
+parts of the aggregate.
+
+ 6. Conveying Non-Source Forms.
+
+ You may convey a covered work in object code form under the terms
+of sections 4 and 5, provided that you also convey the
+machine-readable Corresponding Source under the terms of this License,
+in one of these ways:
+
+ a) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by the
+ Corresponding Source fixed on a durable physical medium
+ customarily used for software interchange.
+
+ b) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by a
+ written offer, valid for at least three years and valid for as
+ long as you offer spare parts or customer support for that product
+ model, to give anyone who possesses the object code either (1) a
+ copy of the Corresponding Source for all the software in the
+ product that is covered by this License, on a durable physical
+ medium customarily used for software interchange, for a price no
+ more than your reasonable cost of physically performing this
+ conveying of source, or (2) access to copy the
+ Corresponding Source from a network server at no charge.
+
+ c) Convey individual copies of the object code with a copy of the
+ written offer to provide the Corresponding Source. This
+ alternative is allowed only occasionally and noncommercially, and
+ only if you received the object code with such an offer, in accord
+ with subsection 6b.
+
+ d) Convey the object code by offering access from a designated
+ place (gratis or for a charge), and offer equivalent access to the
+ Corresponding Source in the same way through the same place at no
+ further charge. You need not require recipients to copy the
+ Corresponding Source along with the object code. If the place to
+ copy the object code is a network server, the Corresponding Source
+ may be on a different server (operated by you or a third party)
+ that supports equivalent copying facilities, provided you maintain
+ clear directions next to the object code saying where to find the
+ Corresponding Source. Regardless of what server hosts the
+ Corresponding Source, you remain obligated to ensure that it is
+ available for as long as needed to satisfy these requirements.
+
+ e) Convey the object code using peer-to-peer transmission, provided
+ you inform other peers where the object code and Corresponding
+ Source of the work are being offered to the general public at no
+ charge under subsection 6d.
+
+ A separable portion of the object code, whose source code is excluded
+from the Corresponding Source as a System Library, need not be
+included in conveying the object code work.
+
+ A "User Product" is either (1) a "consumer product", which means any
+tangible personal property which is normally used for personal, family,
+or household purposes, or (2) anything designed or sold for incorporation
+into a dwelling. In determining whether a product is a consumer product,
+doubtful cases shall be resolved in favor of coverage. For a particular
+product received by a particular user, "normally used" refers to a
+typical or common use of that class of product, regardless of the status
+of the particular user or of the way in which the particular user
+actually uses, or expects or is expected to use, the product. A product
+is a consumer product regardless of whether the product has substantial
+commercial, industrial or non-consumer uses, unless such uses represent
+the only significant mode of use of the product.
+
+ "Installation Information" for a User Product means any methods,
+procedures, authorization keys, or other information required to install
+and execute modified versions of a covered work in that User Product from
+a modified version of its Corresponding Source. The information must
+suffice to ensure that the continued functioning of the modified object
+code is in no case prevented or interfered with solely because
+modification has been made.
+
+ If you convey an object code work under this section in, or with, or
+specifically for use in, a User Product, and the conveying occurs as
+part of a transaction in which the right of possession and use of the
+User Product is transferred to the recipient in perpetuity or for a
+fixed term (regardless of how the transaction is characterized), the
+Corresponding Source conveyed under this section must be accompanied
+by the Installation Information. But this requirement does not apply
+if neither you nor any third party retains the ability to install
+modified object code on the User Product (for example, the work has
+been installed in ROM).
+
+ The requirement to provide Installation Information does not include a
+requirement to continue to provide support service, warranty, or updates
+for a work that has been modified or installed by the recipient, or for
+the User Product in which it has been modified or installed. Access to a
+network may be denied when the modification itself materially and
+adversely affects the operation of the network or violates the rules and
+protocols for communication across the network.
+
+ Corresponding Source conveyed, and Installation Information provided,
+in accord with this section must be in a format that is publicly
+documented (and with an implementation available to the public in
+source code form), and must require no special password or key for
+unpacking, reading or copying.
+
+ 7. Additional Terms.
+
+ "Additional permissions" are terms that supplement the terms of this
+License by making exceptions from one or more of its conditions.
+Additional permissions that are applicable to the entire Program shall
+be treated as though they were included in this License, to the extent
+that they are valid under applicable law. If additional permissions
+apply only to part of the Program, that part may be used separately
+under those permissions, but the entire Program remains governed by
+this License without regard to the additional permissions.
+
+ When you convey a copy of a covered work, you may at your option
+remove any additional permissions from that copy, or from any part of
+it. (Additional permissions may be written to require their own
+removal in certain cases when you modify the work.) You may place
+additional permissions on material, added by you to a covered work,
+for which you have or can give appropriate copyright permission.
+
+ Notwithstanding any other provision of this License, for material you
+add to a covered work, you may (if authorized by the copyright holders of
+that material) supplement the terms of this License with terms:
+
+ a) Disclaiming warranty or limiting liability differently from the
+ terms of sections 15 and 16 of this License; or
+
+ b) Requiring preservation of specified reasonable legal notices or
+ author attributions in that material or in the Appropriate Legal
+ Notices displayed by works containing it; or
+
+ c) Prohibiting misrepresentation of the origin of that material, or
+ requiring that modified versions of such material be marked in
+ reasonable ways as different from the original version; or
+
+ d) Limiting the use for publicity purposes of names of licensors or
+ authors of the material; or
+
+ e) Declining to grant rights under trademark law for use of some
+ trade names, trademarks, or service marks; or
+
+ f) Requiring indemnification of licensors and authors of that
+ material by anyone who conveys the material (or modified versions of
+ it) with contractual assumptions of liability to the recipient, for
+ any liability that these contractual assumptions directly impose on
+ those licensors and authors.
+
+ All other non-permissive additional terms are considered "further
+restrictions" within the meaning of section 10. If the Program as you
+received it, or any part of it, contains a notice stating that it is
+governed by this License along with a term that is a further
+restriction, you may remove that term. If a license document contains
+a further restriction but permits relicensing or conveying under this
+License, you may add to a covered work material governed by the terms
+of that license document, provided that the further restriction does
+not survive such relicensing or conveying.
+
+ If you add terms to a covered work in accord with this section, you
+must place, in the relevant source files, a statement of the
+additional terms that apply to those files, or a notice indicating
+where to find the applicable terms.
+
+ Additional terms, permissive or non-permissive, may be stated in the
+form of a separately written license, or stated as exceptions;
+the above requirements apply either way.
+
+ 8. Termination.
+
+ You may not propagate or modify a covered work except as expressly
+provided under this License. Any attempt otherwise to propagate or
+modify it is void, and will automatically terminate your rights under
+this License (including any patent licenses granted under the third
+paragraph of section 11).
+
+ However, if you cease all violation of this License, then your
+license from a particular copyright holder is reinstated (a)
+provisionally, unless and until the copyright holder explicitly and
+finally terminates your license, and (b) permanently, if the copyright
+holder fails to notify you of the violation by some reasonable means
+prior to 60 days after the cessation.
+
+ Moreover, your license from a particular copyright holder is
+reinstated permanently if the copyright holder notifies you of the
+violation by some reasonable means, this is the first time you have
+received notice of violation of this License (for any work) from that
+copyright holder, and you cure the violation prior to 30 days after
+your receipt of the notice.
+
+ Termination of your rights under this section does not terminate the
+licenses of parties who have received copies or rights from you under
+this License. If your rights have been terminated and not permanently
+reinstated, you do not qualify to receive new licenses for the same
+material under section 10.
+
+ 9. Acceptance Not Required for Having Copies.
+
+ You are not required to accept this License in order to receive or
+run a copy of the Program. Ancillary propagation of a covered work
+occurring solely as a consequence of using peer-to-peer transmission
+to receive a copy likewise does not require acceptance. However,
+nothing other than this License grants you permission to propagate or
+modify any covered work. These actions infringe copyright if you do
+not accept this License. Therefore, by modifying or propagating a
+covered work, you indicate your acceptance of this License to do so.
+
+ 10. Automatic Licensing of Downstream Recipients.
+
+ Each time you convey a covered work, the recipient automatically
+receives a license from the original licensors, to run, modify and
+propagate that work, subject to this License. You are not responsible
+for enforcing compliance by third parties with this License.
+
+ An "entity transaction" is a transaction transferring control of an
+organization, or substantially all assets of one, or subdividing an
+organization, or merging organizations. If propagation of a covered
+work results from an entity transaction, each party to that
+transaction who receives a copy of the work also receives whatever
+licenses to the work the party's predecessor in interest had or could
+give under the previous paragraph, plus a right to possession of the
+Corresponding Source of the work from the predecessor in interest, if
+the predecessor has it or can get it with reasonable efforts.
+
+ You may not impose any further restrictions on the exercise of the
+rights granted or affirmed under this License. For example, you may
+not impose a license fee, royalty, or other charge for exercise of
+rights granted under this License, and you may not initiate litigation
+(including a cross-claim or counterclaim in a lawsuit) alleging that
+any patent claim is infringed by making, using, selling, offering for
+sale, or importing the Program or any portion of it.
+
+ 11. Patents.
+
+ A "contributor" is a copyright holder who authorizes use under this
+License of the Program or a work on which the Program is based. The
+work thus licensed is called the contributor's "contributor version".
+
+ A contributor's "essential patent claims" are all patent claims
+owned or controlled by the contributor, whether already acquired or
+hereafter acquired, that would be infringed by some manner, permitted
+by this License, of making, using, or selling its contributor version,
+but do not include claims that would be infringed only as a
+consequence of further modification of the contributor version. For
+purposes of this definition, "control" includes the right to grant
+patent sublicenses in a manner consistent with the requirements of
+this License.
+
+ Each contributor grants you a non-exclusive, worldwide, royalty-free
+patent license under the contributor's essential patent claims, to
+make, use, sell, offer for sale, import and otherwise run, modify and
+propagate the contents of its contributor version.
+
+ In the following three paragraphs, a "patent license" is any express
+agreement or commitment, however denominated, not to enforce a patent
+(such as an express permission to practice a patent or covenant not to
+sue for patent infringement). To "grant" such a patent license to a
+party means to make such an agreement or commitment not to enforce a
+patent against the party.
+
+ If you convey a covered work, knowingly relying on a patent license,
+and the Corresponding Source of the work is not available for anyone
+to copy, free of charge and under the terms of this License, through a
+publicly available network server or other readily accessible means,
+then you must either (1) cause the Corresponding Source to be so
+available, or (2) arrange to deprive yourself of the benefit of the
+patent license for this particular work, or (3) arrange, in a manner
+consistent with the requirements of this License, to extend the patent
+license to downstream recipients. "Knowingly relying" means you have
+actual knowledge that, but for the patent license, your conveying the
+covered work in a country, or your recipient's use of the covered work
+in a country, would infringe one or more identifiable patents in that
+country that you have reason to believe are valid.
+
+ If, pursuant to or in connection with a single transaction or
+arrangement, you convey, or propagate by procuring conveyance of, a
+covered work, and grant a patent license to some of the parties
+receiving the covered work authorizing them to use, propagate, modify
+or convey a specific copy of the covered work, then the patent license
+you grant is automatically extended to all recipients of the covered
+work and works based on it.
+
+ A patent license is "discriminatory" if it does not include within
+the scope of its coverage, prohibits the exercise of, or is
+conditioned on the non-exercise of one or more of the rights that are
+specifically granted under this License. You may not convey a covered
+work if you are a party to an arrangement with a third party that is
+in the business of distributing software, under which you make payment
+to the third party based on the extent of your activity of conveying
+the work, and under which the third party grants, to any of the
+parties who would receive the covered work from you, a discriminatory
+patent license (a) in connection with copies of the covered work
+conveyed by you (or copies made from those copies), or (b) primarily
+for and in connection with specific products or compilations that
+contain the covered work, unless you entered into that arrangement,
+or that patent license was granted, prior to 28 March 2007.
+
+ Nothing in this License shall be construed as excluding or limiting
+any implied license or other defenses to infringement that may
+otherwise be available to you under applicable patent law.
+
+ 12. No Surrender of Others' Freedom.
+
+ If conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot convey a
+covered work so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you may
+not convey it at all. For example, if you agree to terms that obligate you
+to collect a royalty for further conveying from those to whom you convey
+the Program, the only way you could satisfy both those terms and this
+License would be to refrain entirely from conveying the Program.
+
+ 13. Use with the GNU Affero General Public License.
+
+ Notwithstanding any other provision of this License, you have
+permission to link or combine any covered work with a work licensed
+under version 3 of the GNU Affero General Public License into a single
+combined work, and to convey the resulting work. The terms of this
+License will continue to apply to the part which is the covered work,
+but the special requirements of the GNU Affero General Public License,
+section 13, concerning interaction through a network will apply to the
+combination as such.
+
+ 14. Revised Versions of this License.
+
+ The Free Software Foundation may publish revised and/or new versions of
+the GNU General Public License from time to time. Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+ Each version is given a distinguishing version number. If the
+Program specifies that a certain numbered version of the GNU General
+Public License "or any later version" applies to it, you have the
+option of following the terms and conditions either of that numbered
+version or of any later version published by the Free Software
+Foundation. If the Program does not specify a version number of the
+GNU General Public License, you may choose any version ever published
+by the Free Software Foundation.
+
+ If the Program specifies that a proxy can decide which future
+versions of the GNU General Public License can be used, that proxy's
+public statement of acceptance of a version permanently authorizes you
+to choose that version for the Program.
+
+ Later license versions may give you additional or different
+permissions. However, no additional obligations are imposed on any
+author or copyright holder as a result of your choosing to follow a
+later version.
+
+ 15. Disclaimer of Warranty.
+
+ THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
+APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
+IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+ 16. Limitation of Liability.
+
+ IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
+THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
+GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
+USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
+DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
+PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
+EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGES.
+
+ 17. Interpretation of Sections 15 and 16.
+
+ If the disclaimer of warranty and limitation of liability provided
+above cannot be given local legal effect according to their terms,
+reviewing courts shall apply local law that most closely approximates
+an absolute waiver of all civil liability in connection with the
+Program, unless a warranty or assumption of liability accompanies a
+copy of the Program in return for a fee.
+
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
+
+ If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+ To do so, attach the following notices to the program. It is safest
+to attach them to the start of each source file to most effectively
+state the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+
+ Copyright (C)
+
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License
+ along with this program. If not, see .
+
+Also add information on how to contact you by electronic and paper mail.
+
+ If the program does terminal interaction, make it output a short
+notice like this when it starts in an interactive mode:
+
+ Copyright (C)
+ This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+ This is free software, and you are welcome to redistribute it
+ under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License. Of course, your program's commands
+might be different; for a GUI interface, you would use an "about box".
+
+ You should also get your employer (if you work as a programmer) or school,
+if any, to sign a "copyright disclaimer" for the program, if necessary.
+For more information on this, and how to apply and follow the GNU GPL, see
+.
+
+ The GNU General Public License does not permit incorporating your program
+into proprietary programs. If your program is a subroutine library, you
+may consider it more useful to permit linking proprietary applications with
+the library. If this is what you want to do, use the GNU Lesser General
+Public License instead of this License. But first, please read
+.
diff --git a/pip-wheel-metadata/graphkb.dist-info/METADATA b/pip-wheel-metadata/graphkb.dist-info/METADATA
new file mode 100644
index 0000000..7990feb
--- /dev/null
+++ b/pip-wheel-metadata/graphkb.dist-info/METADATA
@@ -0,0 +1,111 @@
+Metadata-Version: 2.1
+Name: graphkb
+Version: 1.13.0
+Summary: python adapter for interacting with the GraphKB API
+Home-page: https://github.com/bcgsc/pori_graphkb_python
+Author-email: graphkb@bcgsc.ca
+License: UNKNOWN
+Platform: UNKNOWN
+Requires-Python: >=3.6
+Description-Content-Type: text/markdown
+Requires-Dist: requests (<2.29.0)
+Requires-Dist: typing-extensions (<4.4,>=3.7.4.2)
+Provides-Extra: deploy
+Requires-Dist: twine ; extra == 'deploy'
+Requires-Dist: wheel ; extra == 'deploy'
+Provides-Extra: dev
+Requires-Dist: twine ; extra == 'dev'
+Requires-Dist: wheel ; extra == 'dev'
+Requires-Dist: pytest ; extra == 'dev'
+Requires-Dist: pytest-runner ; extra == 'dev'
+Requires-Dist: pytest-cov ; extra == 'dev'
+Requires-Dist: mkdocs ; extra == 'dev'
+Requires-Dist: markdown-refdocs ; extra == 'dev'
+Requires-Dist: mkdocs-material ; extra == 'dev'
+Requires-Dist: mkdocs-redirects ; extra == 'dev'
+Requires-Dist: black ; extra == 'dev'
+Requires-Dist: flake8 ; extra == 'dev'
+Requires-Dist: flake8-annotations ; extra == 'dev'
+Requires-Dist: isort ; extra == 'dev'
+Requires-Dist: mypy ; extra == 'dev'
+Provides-Extra: doc
+Requires-Dist: mkdocs ; extra == 'doc'
+Requires-Dist: markdown-refdocs ; extra == 'doc'
+Requires-Dist: mkdocs-material ; extra == 'doc'
+Requires-Dist: mkdocs-redirects ; extra == 'doc'
+Provides-Extra: test
+Requires-Dist: pytest ; extra == 'test'
+Requires-Dist: pytest-runner ; extra == 'test'
+Requires-Dist: pytest-cov ; extra == 'test'
+
+
+# GraphKB (Python)
+
+ [](https://pypi.org/project/graphkb) [](https://codecov.io/gh/bcgsc/pori_graphkb_python) [](https://pypistats.org/packages/graphkb) [](https://doi.org/10.5281/zenodo.5730523)
+
+This repository is part of the [platform for oncogenomic reporting and interpretation](https://github.com/bcgsc/pori).
+
+Python adapter package for querying the GraphKB API. See the [user manual](https://bcgsc.github.io/pori/graphkb/scripting/)
+
+- [Getting Started](#getting-started)
+ - [Install (For developers)](#install-for-developers)
+ - [Run Tests](#run-tests)
+- [Generating the Documentation](#generating-the-documentation)
+- [Deployment (Publishing)](#deployment-publishing)
+
+## Getting Started
+
+### Install (For developers)
+
+clone this repository
+
+```bash
+git clone https://github.com/bcgsc/pori_graphkb_python
+cd pori_graphkb_python
+```
+
+create a virtual environment
+
+```bash
+python3 -m venv venv
+source venv/bin/activate
+```
+
+install the package and its development dependencies
+
+```bash
+pip install -U pip setuptools
+pip install -e .[dev]
+```
+
+### Run Tests
+
+```bash
+pytest tests
+```
+
+## Generating the Documentation
+
+User documentation for this repository is hosted in the [central PORI repository](https://github.com/bcgsc/pori/)
+
+## Deployment (Publishing)
+
+Install the deployment dependencies
+
+```bash
+pip install .[deploy]
+```
+
+Build the distribution files
+
+```bash
+python setup.py install sdist bdist_wheel
+```
+
+Upload the distibutions to the package server (`-r` is defined in your pypirc)
+
+```bash
+twine upload -r bcgsc dist/*
+```
+
+
diff --git a/pip-wheel-metadata/graphkb.dist-info/dependency_links.txt b/pip-wheel-metadata/graphkb.dist-info/dependency_links.txt
new file mode 100644
index 0000000..fe51488
--- /dev/null
+++ b/pip-wheel-metadata/graphkb.dist-info/dependency_links.txt
@@ -0,0 +1 @@
+[]
diff --git a/pip-wheel-metadata/graphkb.dist-info/top_level.txt b/pip-wheel-metadata/graphkb.dist-info/top_level.txt
new file mode 100644
index 0000000..f49b9b0
--- /dev/null
+++ b/pip-wheel-metadata/graphkb.dist-info/top_level.txt
@@ -0,0 +1,2 @@
+graphkb
+tests
diff --git a/script_cancer_genes.py b/script_cancer_genes.py
new file mode 100644
index 0000000..dff4511
--- /dev/null
+++ b/script_cancer_genes.py
@@ -0,0 +1,43 @@
+from graphkb.genes import _get_tumourigenesis_genes_list, get_cancer_genes, get_oncokb_oncogenes, get_oncokb_tumour_supressors
+from graphkb.constants import TSO500_SOURCE_NAME, ONCOKB_SOURCE_NAME, CANCER_GENE
+
+from script_conn import connection
+
+
+# CONNECTION
+##############################################################
+env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+
+# oncogenic = get_oncokb_oncogenes(conn)
+# print(f'\noncogenic genes:')
+# print(len(oncogenic))
+# print(oncogenic[0])
+
+# suppressor = get_oncokb_tumour_supressors(conn)
+# print(f'\nsuppressor genes:')
+# print(len(suppressor))
+# print(suppressor[0])
+
+cancer_genes = get_cancer_genes(conn)
+print(f'cancer genes ({len(cancer_genes)}) :')
+# print(len(cancer_genes))
+geneList = [gene["displayName"] for gene in cancer_genes]
+geneList.sort()
+for gene in geneList:
+ print(gene)
+
+
+# cancer_genes2 = _get_tumourigenesis_genes_list(
+# conn,
+# CANCER_GENE,
+# [
+# ONCOKB_SOURCE_NAME,
+# TSO500_SOURCE_NAME,
+# ]
+# )
+# print(f'\ncancer_genes2:')
+# print(len(cancer_genes2))
+# print(cancer_genes2[0])
+
diff --git a/script_conn.py b/script_conn.py
new file mode 100644
index 0000000..c19dee6
--- /dev/null
+++ b/script_conn.py
@@ -0,0 +1,28 @@
+import os
+from graphkb import GraphKBConnection
+
+GKB_USER = {
+ "local" : os.environ['USER'],
+ "dev" : os.environ['USER'],
+ # "staging" : 'graphkb_importer',
+ "staging" : os.environ['USER'],
+ "prod" : os.environ['USER'],
+}
+GKB_PASSWORD = {
+ "local" : os.environ['JIRA_PASS'],
+ "dev" : os.environ['JIRA_PASS'],
+ # "staging" : os.environ['GKB_PASS'],
+ "staging" : os.environ['JIRA_PASS'],
+ "prod" : os.environ['JIRA_PASS'],
+}
+GKB_API_URL = {
+ "local" : "http://mlemieux01.phage.bcgsc.ca:8080/api/",
+ "dev" : "https://graphkbdev-api.bcgsc.ca/api",
+ "staging" : "https://graphkbstaging-api.bcgsc.ca/api",
+ "prod" : "https://graphkb-api.bcgsc.ca/api",
+}
+
+def connection(env):
+ conn = GraphKBConnection(GKB_API_URL[env], use_global_cache=False)
+ conn.login(GKB_USER[env], GKB_PASSWORD[env])
+ return conn
\ No newline at end of file
diff --git a/script_data.py b/script_data.py
new file mode 100644
index 0000000..d6093ff
--- /dev/null
+++ b/script_data.py
@@ -0,0 +1,88 @@
+variant_strings = {
+ "GERO-299": [
+ "chr17:g.7674252C>T",
+ "ENST00000269305:c.711G>A",
+ "TP53:p.M237I",
+ ],
+ "KBDEV-1024": [
+ "TSC2:c.3365G>C",
+ "NM_000548.5:c.3365G>A",
+ "NM_000548.5:p.Arg1122His",
+ "TSC2: p.R112H",
+ ],
+ "KBDEV-1038": [
+ "FGFR4:p.N535K",
+ "EGFR:p.D942N",
+ ],
+ "KBDEV-1044": [
+ "TSC2:c.4700G>A",
+ ],
+ "KBDEV-1052": [
+ "EGFR:c.28246G>A",
+ "chr7:g.55198839G>A",
+ "EGFR:p.D942N",
+ # dummy test for Infers edges
+ "(PCM1,JAK2):fusion(r.6280,r.1821)",
+ ],
+ "KBDEV-1054": [
+ "ERBB2:p.R814C",
+ ],
+ "KBDEV-1056": [
+ "FGFR3:c.1212dupC",
+ "FGFR3:c.1212dupACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
+ "FGFR3:c.1212_1213insC",
+ "FGFR3:c.1212C>A",
+ "chr1:g.33344590_33344592del",
+ "chr1:g.33344590_33344692del",
+ "FGFR3:g.5000_5001del",
+ "FGFR3:g.5000_5100del",
+ "FGFR3:c.9002_9050delinsTTT",
+ "FGFR3:c.9002_9051delinsTTT",
+ ],
+ "KBDEV-1066": [
+ # "(TMPRSS2,ERG):fusion(r.150,r.312)",
+ "(FUS,CREB3L2):fusion(r.904,r.936)",
+ ],
+ "KBDEV-1133": [
+ # "EGFR:p.C797S",
+ # "EGFR:c.2127A>T",
+ "EGFR:p.V30_R297del",
+ # "EGFR:p.E746_S752delinsI",
+ # "EGFR:p.E746_S752del",
+ # "VHL:p.T133Lfs*26",
+ # "(BRAF,AKAP9):fusion(e.8,e.9)",
+ # "(TFE3,PRCC):fusion(r.794,r.741)",
+ # "(CD74,ROS1):fusion(r.627,r.5841)",
+ # "VHL:p.V66Gfs*10",
+ # "VHL:p.V66Gfs*89",
+ # "VHL:p.Q96_P97delinsH",
+ # "VHL:p.Q96_P97delinsHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH",
+ # "VHL:c.483delA",
+ # "VHL:c.483delinsC",
+
+ ],
+ "SDEV-3872": [
+ # "(FGFR3,BRCA2):fusion(g.1234567,g.1234567)",
+ # "STK11:g.1_100del",
+ # "STK11:g.1_10del",
+ # "STK11:e.1_100del",
+ # "STK11:i.1_100del",
+ # "FGFR3:c.1200_1300dup",
+ # "NC_000002.12:g.233760247_233760248dup",
+ # "chr2:g.233760247_233760248dup",
+ # "UGT1A1:g.233760247_233760248dup",
+ # "NM_000548.5:c.3365G>A",
+ 'chr7:g.55181378C>T',
+ ],
+ "SDEV-3892": [
+ "(ESR1,CCDC170):fusion(e.5,e.2)",
+ "(ESR1,CCDC170):fusion(e.2,e.6)",
+ ],
+ "other": [
+ "ENST00000219476:c.4700_4701delinsAT",
+ "NM_000548.5:c.3365G>A",
+ "TSC2:p.R112H",
+ "TSC2:p.G1567D",
+ "KRAS:p.G12D",
+ ],
+}
diff --git a/script_features.py b/script_features.py
new file mode 100644
index 0000000..a65e95d
--- /dev/null
+++ b/script_features.py
@@ -0,0 +1,27 @@
+from graphkb.match import get_equivalent_features
+
+from script_conn import connection
+
+
+def main():
+ # CONNECTION
+ ##############################################################
+ env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+ conn = connection(env)
+
+ # DATA
+ ##############################################################
+ source_name = 'entrez gene'
+ gene_name = 'H3F3B'
+
+ # PROCESSING
+ ##############################################################
+ features = get_equivalent_features(conn, gene_name)
+
+ source_rid = conn.get_source(source_name)['@rid']
+ features = [el for el in features if el['source'] == source_rid]
+
+ if len(features) == 1:
+ return features[0]
+
+main()
\ No newline at end of file
diff --git a/script_genes_get_gene_info.py b/script_genes_get_gene_info.py
new file mode 100644
index 0000000..a217b61
--- /dev/null
+++ b/script_genes_get_gene_info.py
@@ -0,0 +1,16 @@
+from graphkb.genes import get_gene_information
+from script_conn import connection
+
+# CONNECTION
+##############################################################
+env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# DATA
+##############################################################
+genes = ['BRCA2', 'ALB']
+info = get_gene_information(conn, genes)
+
+# LOGGING
+##############################################################
+print(info)
diff --git a/script_genes_oncokb.py b/script_genes_oncokb.py
new file mode 100644
index 0000000..c019dc5
--- /dev/null
+++ b/script_genes_oncokb.py
@@ -0,0 +1,21 @@
+from graphkb.genes import get_oncokb_oncogenes, get_oncokb_tumour_supressors
+
+from script_conn import connection
+
+
+# CONNECTION
+##############################################################
+env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+
+oncogenic = get_oncokb_oncogenes(conn)
+print(f'oncogenic genes: {len(oncogenic)}')
+print(oncogenic)
+# for gene in oncogenic:
+# print(gene['displayName'])
+
+suppressor = get_oncokb_tumour_supressors(conn)
+print(f'suppressor genes: {len(suppressor)}')
+# for gene in suppressor:
+# print(gene['displayName'])
diff --git a/script_genes_predispositions.py b/script_genes_predispositions.py
new file mode 100644
index 0000000..ff00148
--- /dev/null
+++ b/script_genes_predispositions.py
@@ -0,0 +1,31 @@
+from graphkb.genes import get_cancer_predisposition_info, get_pharmacogenomic_info
+
+from script_conn import connection
+
+
+# CONNECTION
+##############################################################
+env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# get_cancer_predisposition_info
+genes, variants = get_cancer_predisposition_info(conn)
+print('\nget_cancer_predisposition_info', '\n#############################################')
+print(f'\ngenes: {len(genes)}', '\n**************************')
+with open("genes.txt", "w") as f:
+ for gene in genes:
+ print(gene, file=f)
+print(f'\nvariants: {len(variants)}', '\n**************************')
+with open("variants.tsv", "w") as f:
+ for k, v in variants.items():
+ print(k, v, sep="\t", file=f)
+
+# # get_pharmacogenomic_info
+# genes, variants = get_pharmacogenomic_info(conn)
+# print('\nget_pharmacogenomic_info', '\n#############################################')
+# print(f'\ngenes: {len(genes)}', '\n**************************')
+# for gene in genes:
+# print(gene)
+# print(f'\nvariants: {len(variants)}', '\n**************************')
+# for k, v in variants.items():
+# print(k, v)
diff --git a/script_get_equivalent_features.py b/script_get_equivalent_features.py
new file mode 100644
index 0000000..1ece6ae
--- /dev/null
+++ b/script_get_equivalent_features.py
@@ -0,0 +1,38 @@
+from graphkb.match import get_equivalent_features
+from script_conn import connection
+
+# CONNECTION
+##############################################################
+env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# DATA
+##############################################################
+gene = 'BRCA2'
+features = get_equivalent_features(conn, gene)
+
+# LOGGING
+##############################################################
+for feature in features:
+ print(
+ f'- {feature["@rid"]} - {feature["biotype"]} - {feature["displayName"]} - source: {feature["source"]}'
+ )
+
+# # displayName list
+# variant = [i['displayName'] for i in matches]
+# variant = sorted(list(set(variant)))
+
+# print(f"\nvariant matches: {len(variant)}")
+# for pv in variant:
+# print(f'- {pv}')
+
+# # type list
+# types = [i.get('type', {}).get('displayName', '') for i in matches]
+# types = set(types)
+# types.discard('')
+# types = sorted(list(types))
+
+# print(f"\ntype matches: {len(types)}:")
+# for t in types:
+# print(f'- {t}')
+# print()
diff --git a/script_match.py b/script_match.py
new file mode 100644
index 0000000..1b938aa
--- /dev/null
+++ b/script_match.py
@@ -0,0 +1,41 @@
+from graphkb import match
+from script_conn import connection
+from script_data import variant_strings
+
+# CONNECTION
+##############################################################
+env = "dev" # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# DATA
+##############################################################
+variant_string_list = variant_strings.get('KBDEV-1133', {}) # type filtering
+# variant_string_list = variant_strings.get("KBDEV-1056", {}) # structural variant
+
+
+for variant_string in variant_string_list:
+ print(f"{'='*50}\n{variant_string}")
+
+ # # PARSING ONLY
+ # ##############################################################
+ # parsed = conn.parse(variant_string)
+
+ # MATCHING
+ ##############################################################
+ matches = match.match_positional_variant(
+ conn,
+ variant_string,
+ # delinsSpecialHandling=False,
+ # updateTypeList=True,
+ )
+
+ variants = matches
+ # variants = [i["displayName"] for i in matches]
+ # variants = sorted(list(set(variants)))
+
+ print(f"\nvariants matches: {len(variants)}")
+ for pv in variants:
+ print(f"\n- {pv}")
+
+ # types = [i["type"] for i in matches]
+ # types = set()
diff --git a/script_moa.py b/script_moa.py
new file mode 100644
index 0000000..3fe9704
--- /dev/null
+++ b/script_moa.py
@@ -0,0 +1,26 @@
+import requests
+
+url = "https://moalmanac.org/api/assertions"
+moa_lst = [
+ 72, 292, 293, 429, 431, 430, 289, 537, 557, 566, 567, 306, 291, 576
+]
+
+def fnc1(assertion):
+ for feature in assertion['features']:
+ if feature['feature_type'] == 'somatic_variant':
+ return True
+ return False
+
+res = requests.get(url)
+moa = res.json()
+
+moa_filtered = filter(lambda x: x['assertion_id'] in moa_lst, moa)
+moa_filtered2 = filter(fnc1, moa)
+
+for i in moa_filtered:
+ assertion_id = i['assertion_id']
+ feature_type = [j['feature_type'] for j in i['features']]
+ print(assertion_id, feature_type)
+
+for i in moa_filtered2:
+ print(i['assertion_id'])
\ No newline at end of file
diff --git a/script_package_metadata.py b/script_package_metadata.py
new file mode 100644
index 0000000..bc10be4
--- /dev/null
+++ b/script_package_metadata.py
@@ -0,0 +1,28 @@
+import io
+import json
+import tarfile
+
+import requests
+
+# Define the package name and version
+registry_url = "https://registry.npmjs.org"
+package_scope = "@bcgsc-pori/"
+package_name = "graphkb-parser"
+package_version = "2.0.0"
+
+# Package's metadata
+metadata_url = f"{registry_url}/{package_scope}{package_name}/{package_version}"
+metadata_req = requests.get(metadata_url)
+
+# Package tarball
+metadata = metadata_req.content.decode("utf-8")
+tarfile_url = json.loads(metadata)['dist']['tarball']
+tarfile_req = requests.get(tarfile_url)
+
+# Extract tarball into memory
+with tarfile.open(fileobj=io.BytesIO(tarfile_req.content), mode="r:gz") as tar:
+ for i in tar.getmembers():
+ print(i)
+ # main_file = tar.extractfile(f"{package_name}-{package_version}/graphkb-parser.js")
+ # contents = main_file.read()
+ # print(contents)
diff --git a/script_positions.py b/script_positions.py
new file mode 100644
index 0000000..d96ff02
--- /dev/null
+++ b/script_positions.py
@@ -0,0 +1,43 @@
+from graphkb import match
+from script_conn import connection
+
+# CONNECTION
+##############################################################
+env = 'dev' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# DATA
+##############################################################
+
+
+
+
+for variant_string in variant_string_list:
+ print(f"{'='*50}\n{variant_string}")
+
+ # # PARSING ONLY
+ # ##############################################################
+ # parsed = conn.parse(variant_string)
+
+ # MATCHING
+ ##############################################################
+ matches = match.match_positional_variant(conn, variant_string)
+
+ # displayName list
+ variant = [i['displayName'] for i in matches]
+ variant = sorted(list(set(variant)))
+
+ print(f"\nvariant matches: {len(variant)}")
+ for pv in variant:
+ print(f'- {pv}')
+
+ # # type list
+ # types = [i.get('type', {}).get('displayName', '') for i in matches]
+ # types = set(types)
+ # types.discard('')
+ # types = sorted(list(types))
+
+ # print(f"\ntype matches: {len(types)}:")
+ # for t in types:
+ # print(f'- {t}')
+ # print()
diff --git a/script_query.py b/script_query.py
new file mode 100644
index 0000000..a5d5d87
--- /dev/null
+++ b/script_query.py
@@ -0,0 +1,43 @@
+import os
+from typing import Dict, Iterable, List, Set
+
+from graphkb import GraphKBConnection, constants, match, types, util, vocab
+
+# GKB_API_URL: str = 'https://graphkbdev-api.bcgsc.ca/api' # 'http://mlemieux01.phage.bcgsc.ca:8080/api/' #
+GKB_USER: str = os.environ['USER']
+GKB_PASSWORD: str = os.environ['JIRA_PASS']
+
+# conn = GraphKBConnection(GKB_API_URL, use_global_cache=False)
+conn = GraphKBConnection()
+conn.login(GKB_USER, GKB_PASSWORD)
+
+# gene_name: str = "TSC2" #"TP53"
+# category: str = "small mutation" #"substitution"
+# variant_string: str = "TSC2:c.3365G>C"
+# variant_string: str = "TSC2:c.4700G>A"
+variant_string: str = "KRAS:p.G12D"
+
+# # match_positional_variant()
+# positional_variant: List[types.Variant] = match.match_positional_variant(conn, variant_string)
+# # positional_variant = list(set(positional_variant))
+# # positional_variant = sorted(positional_variant, key=lambda d: d['displayName'])
+# displayNames = [i['displayName'] for i in positional_variant]
+# displayNames = sorted(list(set(displayNames)))
+# print(f"\nmatches for positional variant {variant_string} ({len(displayNames)}):")
+# for pv in displayNames:
+# print(pv)
+
+query_filters = [
+ {'reference1': ['#127:91609', '#128:64304', '#125:94839', '#127:3145', '#125:33712', '#127:64304', '#128:94838', '#126:3145', '#128:33711', '#126:64304', '#127:94838', '#125:3145', '#127:33711', '#125:64304', '#126:94838', '#128:3144', '#126:33711', '#127:11256', '#127:42139', '#127:103287', '#125:42140', '#126:103287', '#125:103287', '#126:11256', '#126:72410', '#128:11256', '#125:72410', '#128:72409', '#128:42139']},
+ {'reference2': None},
+ {'type': ['#145:43', '#145:66', '#145:31', '#145:23', '#145:53', '#148:18', '#145:67', '#148:37']},
+ # {'break1Start.@class': 'ProteinPosition'}
+]
+
+res = conn.query(
+ {'target': 'PositionalVariant', 'filters': query_filters}
+),
+
+for i in res[0]:
+ print(i['displayName'])
+print(len(res[0]))
\ No newline at end of file
diff --git a/script_statement.py b/script_statement.py
new file mode 100644
index 0000000..e25211d
--- /dev/null
+++ b/script_statement.py
@@ -0,0 +1,71 @@
+import subprocess, json
+
+from graphkb import match, statement
+
+from script_data import variant_strings
+from script_conn import connection
+
+
+# CONNECTION
+##############################################################
+env = 'prod' # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# DATASET
+##############################################################
+variant_string_list = variant_strings.get('SDEV-3892', {})
+
+# MATCHING VARIANTS
+variants = []
+##############################################################
+for variant_string in variant_string_list:
+ print(f"{'='*50}\n{variant_string}")
+
+ # matching variants
+ matches = match.match_positional_variant(conn, variant_string)
+ variants += matches
+
+ # displayName list
+ variant = [f"{i['@rid']} {i['displayName']}" for i in matches]
+ variant = sorted(list(set(variant)))
+
+ print(f"\nvariant matches: {len(variant)}")
+ for pv in variant:
+ print(f'- {pv}')
+
+ # type list
+ types = [i.get('type', {}).get('displayName', '') for i in matches]
+ types = set(types)
+ types.discard('')
+ types = sorted(list(types))
+
+ print(f"\ntype matches: {len(types)}:")
+ for t in types:
+ print(f'- {t}')
+ print()
+
+
+
+# MATCHING STATEMENTS
+##############################################################
+
+# variant_records = conn.query({})
+
+statements = statement.get_statements_from_variants(conn, variants)
+print(f"statements: {len(statements)}")
+for i in statements:
+ print(i['@rid'])
+
+x = conn.query({"target":"Statement", "filters": {"conditions": ['#162:149'], "operator": "CONTAINSANY"},})
+print(f"matching #162:149: {len(x)}")
+for i in x: print(i['@rid'])
+
+# statement template display
+print(x[0])
+print('='*50)
+
+s = json.dumps(x[0])
+# s = str(x[0])
+p = subprocess.Popen(f"""node displayStatement.js '{s}'""", stdout=subprocess.PIPE, shell=True)
+print('%'*50)
+print(p.communicate())
\ No newline at end of file
diff --git a/script_struct.py b/script_struct.py
new file mode 100644
index 0000000..fc9d5a3
--- /dev/null
+++ b/script_struct.py
@@ -0,0 +1,31 @@
+import os
+
+from graphkb import GraphKBConnection, constants, match # , types, util, vocab
+from graphkb.vocab import get_equivalent_terms, get_term_tree
+
+# # Production
+# GKB_API_URL: str = 'https://graphkb-api.bcgsc.ca/api'
+# GKB_USER: str = os.environ['USER']
+# GKB_PASSWORD: str = os.environ['JIRA_PASS']
+
+# # Staging
+# GKB_API_URL: str = 'https://graphkbstaging-api.bcgsc.ca/api'
+# GKB_USER: str = 'graphkb_importer'
+# GKB_PASSWORD: str = os.environ['GKB_PASS']
+
+# Dev
+GKB_API_URL: str = 'https://graphkbdev-api.bcgsc.ca/api'
+GKB_USER: str = os.environ['USER']
+GKB_PASSWORD: str = os.environ['JIRA_PASS']
+
+# # Local
+# GKB_API_URL: str = 'http://mlemieux01.phage.bcgsc.ca:8080/api/'
+# GKB_USER: str = os.environ['USER']
+# GKB_PASSWORD: str = os.environ['JIRA_PASS']
+
+conn = GraphKBConnection(GKB_API_URL, use_global_cache=False) # conn = GraphKBConnection()
+conn.login(GKB_USER, GKB_PASSWORD)
+
+
+#
+matches = match.type_screening(conn, {"type": "duplication"}, updateTypes=True)
diff --git a/script_vocab.py b/script_vocab.py
new file mode 100644
index 0000000..6833938
--- /dev/null
+++ b/script_vocab.py
@@ -0,0 +1,39 @@
+from graphkb.vocab import get_equivalent_terms, get_term_tree, get_terms_set
+from script_conn import connection
+
+# CONNECTION
+##############################################################
+env = "dev" # 'local' | 'dev' | 'staging' | 'prod'
+conn = connection(env)
+
+# term = "frameshift mutation"
+term = "deletion"
+print("term:", term)
+
+# # get_term_tree
+# terms = get_term_tree(conn, term)
+# print("\nget_terms_tree", "\n#############################################")
+# print(f"\nterms: {len(terms)}", "\n**************************")
+# for t in terms:
+# print(t["@rid"], t["name"])
+
+# get_equivalent_terms
+terms2 = get_equivalent_terms(conn, term)
+print("\nget_equivalent_terms", "\n#############################################")
+print(f"\nterms: {len(terms2)}", "\n**************************")
+for t in terms2:
+ print(t["@rid"], t["name"])
+
+# # get_terms_set
+# terms3 = get_terms_set(conn, [term])
+# print("\nget_terms_set", "\n#############################################")
+# print(f"\nterms: {len(terms3)}", "\n**************************")
+# for t in terms3:
+# print(t)
+
+# # get_term_tree wo/ supercvlasses
+# terms4 = get_term_tree(conn, [term], include_superclasses=False)
+# print("\nget_term_tree wo superclasses", "\n#############################################")
+# print(f"\nterms: {len(terms4)}", "\n**************************")
+# for t in terms4:
+# print(t["@rid"], t["name"])
diff --git a/variants.tsv b/variants.tsv
new file mode 100644
index 0000000..ca0f292
--- /dev/null
+++ b/variants.tsv
@@ -0,0 +1,2807 @@
+#160:2712 AKT1:p.E17K
+#159:3717 NM_000038.4:c.1247delA
+#160:3716 NM_000038.4:c.1312+3A>G
+#157:3745 NM_000038.4:c.1412delG
+#160:3720 NM_000038.4:c.1467_1479delTAATGACCACTAC
+#159:3725 APC:p.K534*
+#159:3727 NM_000038.4:c.1657delT
+#158:3738 NM_000038.4:c.1700delG
+#159:3732 NM_000038.4:c.1776delA
+#157:3759 NM_000038.4:c.1879_1882delAACA
+#158:3745 NM_000038.4:c.207delA
+#157:3763 NM_000038.4:c.2268_2274delACAAAAA
+#159:627 APC:p.Q789*
+#158:3752 NM_000038.4:c.2441_2442delinsG
+#158:3754 APC:p.G839*
+#158:3756 NM_000038.4:c.2544dupA
+#159:1343 APC:p.R876*
+#157:3777 NM_000038.4:c.2814dupT
+#159:3755 NM_000038.4:c.2851delT
+#157:3782 APC:p.E1020*
+#159:3760 NM_000038.4:c.3148dupG
+#160:3759 NM_000038.4:c.3328delT
+#157:3789 NM_000038.4:c.3385_3386delTT
+#158:3775 NM_000038.4:c.3471_3474delGAGA
+#158:3777 NM_000038.4:c.3567dupA
+#157:3795 NM_000038.4:c.3658_3659insT
+#158:3780 NM_000038.4:c.3807_3809delinsTTTT
+#159:3774 NM_000038.4:c.3875delC
+#159:3776 NM_000038.4:c.3885delA
+#158:3786 NM_000038.4:c.3910delA
+#160:3777 APC:p.E1309*
+#158:3791 APC:p.S1315*
+#159:3785 NM_000038.4:c.4046_4059delinsT
+#159:3787 NM_000038.4:c.4062_4066delTTCTT
+#157:3814 APC:p.K1370*
+#157:3816 NM_000038.4:c.4138_4160dupACCCCACTCATGTTTAGCAGATG
+#159:3794 NM_000038.4:c.4199delC
+#158:3804 NM_000038.4:c.4236_4239dupAATG
+#158:3806 NM_000038.4:c.4264delG
+#159:3800 NM_000038.4:c.429_432delGCTT
+#160:3799 APC:p.E1451*
+#160:3801 NM_000038.4:c.4394_4395insGG
+#160:3803 NM_000038.4:c.4464_4473delATTACATTTT
+#160:3805 APC:p.E1513*
+#158:3150 APC:p.E1554*
+#159:3812 NM_000038.4:c.4865delA
+#157:3838 NM_000038.4:c.512_527delGTCTTCCTTTAACTGA
+#160:3812 NM_000038.4:c.5826_5829delCAGA
+#158:3826 APC:p.E225*
+#158:3829 APC:p.G265*
+#160:3820 NM_000038.4:c.896_897delCT
+#157:3850 NM_000051.3:c.1564_1565delGA
+#159:3827 NM_000051.3:c.2284_2285delCT
+#160:3825 NM_000051.3:c.2897_2899delinsGCCAA
+#157:3854 NM_000051.3:c.3802delG
+#157:625 ATM:p.R1875*
+#157:3857 NM_000051.3:c.5870_5871delAT
+#160:3831 NM_000051.3:c.6976-2A>C
+#158:3844 ATM:p.Q2593*
+#159:3837 NM_000051.3:c.8030delAinsGTG
+#157:3863 NM_000051.3:c.8395_8404delTTTCAGTGCC
+#157:3864 NM_004656.2:c.73_98delAAGGGGGTGCAAGTGGAGGAGATCTA
+#160:3838 NM_004329.2:c.367delG
+#160:3840 NM_007294.3:c.1016dupA
+#159:3845 BRCA1:p.E349*
+#159:3847 NM_007294.3:c.1067delA
+#159:3848 NM_007294.3:c.1086_1141delGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA
+#157:3874 BRCA1:p.W372*
+#157:3875 NM_007294.3:c.1127delA
+#158:3860 NM_007294.3:c.117_118delTG
+#160:3850 BRCA1:p.S405*
+#158:3863 BRCA1:p.E418*
+#157:1607 BRCA1:p.L431*
+#158:3866 BRCA1:p.C44S
+#159:3859 BRCA1:p.E445*
+#159:3860 NM_007294.3:c.134+1G>T
+#159:3861 NM_007294.3:c.135-1G>T
+#157:3887 NM_007294.3:c.1360_1361delAG
+#157:3888 NM_007294.3:c.1387delAinsGG
+#159:3865 BRCA1:p.K467*
+#157:3891 NM_007294.3:c.1439dupA
+#157:3892 NM_007294.3:c.1444delA
+#160:3866 BRCA1:p.Q494*
+#158:3879 NM_007294.3:c.1504_1508delTTAAA
+#158:3880 NM_007294.3:c.1510delC
+#159:3873 NM_007294.3:c.1530delA
+#160:3871 BRCA1:p.Q526*
+#158:3884 BRCA1:p.Q538*
+#160:3874 NM_007294.3:c.1638_1646delinsA
+#157:3903 NM_007294.3:c.1713_1717delAGAAT
+#158:3888 BRCA1:p.K583*
+#159:3881 NM_007294.3:c.1772delT
+#159:3883 NM_007294.3:c.179delA
+#159:2735 BRCA1:p.C61G
+#159:3886 NM_007294.3:c.1837delA
+#158:3896 BRCA1:p.L63*
+#159:3889 BRCA1:p.E638*
+#158:3899 BRCA1:p.E649*
+#158:3900 NM_007294.3:c.1959_1960delinsT
+#159:3893 NM_007294.3:c.1961delA
+#157:3919 BRCA1:p.K672*
+#159:3896 BRCA1:p.K679*
+#160:3894 NM_007294.3:c.2071delA
+#157:3923 BRCA1:p.L702*
+#158:3908 NM_007294.3:c.212+1G>C
+#159:1143 BRCA1:p.R71K
+#159:3902 NM_007294.3:c.213-3C>G
+#157:2525 BRCA1:p.E720*
+#160:3902 BRCA1:p.E730*
+#157:3931 NM_007294.3:c.2202delA
+#158:3916 NM_007294.3:c.2210_2211delCA
+#159:3909 BRCA1:p.K739*
+#159:3910 NM_007294.3:c.2253_2254delGT
+#157:3936 BRCA1:p.Q759*
+#158:3921 NM_007294.3:c.2299delA
+#160:3911 NM_007294.3:c.2329delT
+#158:3924 BRCA1:p.Q780*
+#158:3925 NM_007294.3:c.2389_2390delGA
+#159:3918 NM_007294.3:c.2402delG
+#157:3944 BRCA1:p.Q804*
+#159:3921 BRCA1:p.G813*
+#159:3922 NM_007294.3:c.2468delG
+#159:3923 NM_007294.3:c.2477delC
+#159:3924 NM_007294.3:c.2515delC
+#157:3950 BRCA1:p.Q855*
+#159:3927 BRCA1:p.S868*
+#160:3925 NM_007294.3:c.2617dupT
+#158:3938 NM_007294.3:c.2646_2648delTGC
+#158:3939 NM_007294.3:c.2679_2682delGAAA
+#158:3940 NM_007294.3:c.269_281delTTTGTGCTTTTCA
+#159:3933 NM_007294.3:c.2719_2722delGAAG
+#160:3931 NM_007294.3:c.2726dupA
+#160:3933 BRCA1:p.C91*
+#159:3938 BRCA1:p.Q921*
+#159:3939 NM_007294.3:c.2767_2770delGTTA
+#160:3937 NM_007294.3:c.2806_2809delGATA
+#158:3950 NM_007294.3:c.2834_2836delGTA
+#159:3943 NM_007294.3:c.2866_2870delTCTCA
+#160:3941 NM_007294.3:c.2887delA
+#160:3942 NM_007294.3:c.2915delG
+#158:3955 NM_007294.3:c.2934delT
+#159:3948 NM_007294.3:c.2955delC
+#160:3946 NM_007294.3:c.2995_2996delinsTA
+#160:3947 NM_007294.3:c.3013delG
+#157:3976 NM_007294.3:c.302-1G>T
+#157:3977 NM_007294.3:c.302-3C>G
+#159:3954 NM_007294.3:c.3048_3052dupTGAGA
+#157:3980 BRCA1:p.E1033*
+#158:3965 NM_007294.3:c.3158_3159insG
+#159:3958 NM_007294.3:c.3188_3189delinsG
+#159:3959 NM_007294.3:c.3214delC
+#159:3960 NM_007294.3:c.32_33insC
+#157:3986 NM_007294.3:c.3256_3257insGA
+#157:3988 NM_007294.3:c.3286delC
+#157:3989 NM_007294.3:c.3296delC
+#160:3963 BRCA1:p.E1107*
+#160:3964 NM_007294.3:c.3329_3330delAG
+#157:3993 NM_007294.3:c.3333delA
+#160:3967 NM_007294.3:c.3343delG
+#160:3968 NM_007294.3:c.3362delA
+#157:3997 NM_007294.3:c.3390delA
+#160:3971 BRCA1:p.Q1135*
+#157:4000 NM_007294.3:c.342_343delTC
+#158:3985 NM_007294.3:c.3477_3479delinsC
+#159:3978 BRCA1:p.Q12*
+#160:3976 NM_007294.3:c.3549_3550delinsT
+#160:3977 NM_007294.3:c.358delG
+#159:3982 BRCA1:p.K1207*
+#160:3980 BRCA1:p.E1214*
+#157:4009 BRCA1:p.E1221*
+#158:3994 NM_007294.3:c.3688_3733delTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATA
+#157:4012 NM_007294.3:c.3706_3707delAA
+#158:3997 BRCA1:p.Q1240*
+#159:3990 BRCA1:p.E1250*
+#159:3991 NM_007294.3:c.3760_3761insT
+#159:3992 NM_007294.3:c.3771_3772delGG
+#157:4018 NM_007294.3:c.3782delT
+#159:3995 NM_007294.3:c.3825_3826delAT
+#160:3993 NM_007294.3:c.3856delA
+#157:4022 BRCA1:p.K1290*
+#159:3999 NM_007294.3:c.3901_3902delAG
+#158:4009 BRCA1:p.R131*
+#160:3999 BRCA1:p.K1322*
+#157:4028 NM_007294.3:c.3973delA
+#159:4005 NM_007294.3:c.4035delA
+#157:4031 BRCA1:p.E1353*
+#159:4008 BRCA1:p.L1365*
+#159:4009 NM_007294.3:c.4110_4111delTG
+#160:4007 BRCA1:p.E1373*
+#157:4036 NM_007294.3:c.412_418delCTACAGA
+#159:4013 NM_007294.3:c.4161_4162delTC
+#159:4014 NM_007294.3:c.4167_4170delTGAC
+#157:4040 BRCA1:p.Q1395=
+#158:4025 NM_007294.3:c.4210delC
+#160:4015 NM_007294.3:c.4242_4244delinsG
+#158:4028 BRCA1:p.E143*
+#157:4046 NM_007294.3:c.4331_4338delATCCAGAA
+#158:4031 NM_007294.3:c.4357+1G>T
+#160:4021 BRCA1:p.Q1458*
+#158:4034 NM_007294.3:c.4391_4393delinsTT
+#159:4027 NM_007294.3:c.4400_4418delinsTTT
+#158:4037 NM_007294.3:c.4482_4483delAA
+#160:4027 NM_007294.3:c.4485-1G>A
+#159:4032 NM_007294.3:c.4516delG
+#157:4058 NM_007294.3:c.456_457delCA
+#157:4060 BRCA1:p.E1535*
+#160:4034 BRCA1:p.E1540*
+#158:4047 BRCA1:p.Y1552*
+#160:4037 NM_007294.3:c.4675+3A>T
+#158:4050 NM_007294.3:c.4676-2A>G
+#160:4040 NM_007294.3:c.4712_4716delTCTCT
+#160:4041 NM_007294.3:c.4764_4765delTC
+#158:4054 NM_007294.3:c.485dupT
+#160:4044 NM_007294.3:c.4941delC
+#157:4073 NM_007294.3:c.4964_4982delCTGGCCTGACCCCAGAAGA
+#158:4058 NM_007294.3:c.4986+3G>C
+#158:4059 NM_007294.3:c.4986+6T>G
+#160:4049 NM_007294.3:c.5026_5036delTTAACTAATCT
+#160:4050 NM_007294.3:c.5040delT
+#159:4055 NM_007294.3:c.5074+1G>T
+#157:929 BRCA1:p.D1692H
+#158:4066 NM_007294.3:c.5075-2A>C
+#159:4059 NM_007294.3:c.5091_5092delTG
+#158:4069 NM_007294.3:c.5106delA
+#160:4059 NM_007294.3:c.5129delG
+#160:4061 NM_007294.3:c.5145delC
+#157:4090 NM_007294.3:c.5152+1G>A
+#157:4091 NM_007294.3:c.5153-1G>A
+#159:4068 NM_007294.3:c.5155delG
+#157:4094 BRCA1:p.E1725*
+#158:4079 NM_007294.3:c.5193+1G>A
+#158:4080 NM_007294.3:c.5194-1G>A
+#159:4073 NM_007294.3:c.5209_5248delinsTC
+#158:4083 NM_007294.3:c.5229_5230delAA
+#159:4076 NM_007294.3:c.5249dupA
+#159:4078 BRCA1:p.E1754*
+#160:4076 NM_007294.3:c.5277+1delG
+#158:4089 NM_007294.3:c.5278-1G>A
+#158:4090 NM_007294.3:c.5289delG
+#159:4083 NM_007294.3:c.5310dupG
+#160:4081 NM_007294.3:c.5332+1G>A
+#157:4110 NM_007294.3:c.5335delC
+#158:29 BRCA1:p.G1788V
+#158:4097 NM_007294.3:c.5406+1G>A
+#158:4098 NM_007294.3:c.5407-2A>G
+#158:4099 NM_007294.3:c.5440delG
+#157:4117 NM_007294.3:c.5467+2T>C
+#157:4118 NM_007294.3:c.547+1G>A
+#157:4119 NM_007294.3:c.5492delC
+#158:700 BRCA1:p.R1835*
+#157:4122 NM_007294.3:c.5521delA
+#158:39 BRCA1:p.Y1853*
+#160:4098 NM_007294.3:c.668delA
+#160:4099 NM_007294.3:c.676delT
+#157:4128 NM_007294.3:c.70_71insA
+#157:4129 NM_007294.3:c.74_75delCC
+#159:4106 NM_007294.3:c.791_794delGTTC
+#160:4104 NM_007294.3:c.809delA
+#157:4133 NM_007294.3:c.81-2A>T
+#159:4110 NM_007294.3:c.835delC
+#160:4108 BRCA1:p.L283*
+#157:4137 NM_007294.3:c.895_896delGT
+#157:4138 NM_007294.3:c.923delG
+#159:2478 BRCA1:p.Q317*
+#160:4113 NM_007294.3:c.964delG
+#157:4142 BRCA2:p.E34*
+#159:4119 BRCA2:p.S368*
+#160:4117 BRCA2:p.K385*
+#157:4146 NM_000059.3:c.1219delC
+#157:4147 NM_000059.3:c.1257delT
+#158:4132 NM_000059.3:c.128delA
+#158:4133 NM_000059.3:c.1310_1313delAAGA
+#157:4151 BRCA2:p.Q472*
+#159:4128 NM_000059.3:c.1496_1497delAG
+#160:4126 NM_000059.3:c.1547delT
+#160:4127 NM_000059.3:c.1617delA
+#159:680 BRCA2:p.G561*
+#159:4133 NM_000059.3:c.1733delG
+#160:4131 NM_000059.3:c.1773_1776delTTAT
+#159:4136 NM_000059.3:c.1813delA
+#158:4146 NM_000059.3:c.1831delT
+#160:4136 BRCA2:p.Q619*
+#157:4165 NM_000059.3:c.1929delG
+#160:4139 NM_000059.3:c.2036delA
+#158:4152 BRCA2:p.Y688*
+#158:4153 NM_000059.3:c.2094delA
+#158:1560 BRCA2:p.S76*
+#158:4156 BRCA2:p.S791*
+#159:4150 NM_000059.3:c.2435delA
+#159:4151 NM_000059.3:c.2471_2476delTAAATG
+#159:4153 BRCA2:p.S846*
+#159:4154 NM_000059.3:c.2588dupA
+#158:4164 NM_000059.3:c.262_263delCT
+#158:4165 NM_000059.3:c.2653_2656delGACA
+#158:4166 NM_000059.3:c.2731delG
+#159:4159 NM_000059.3:c.2798_2799delCA
+#159:4160 NM_000059.3:c.2810_2811delAA
+#157:4186 NM_000059.3:c.2832_2833insTT
+#158:4171 BRCA2:p.Q961*
+#158:4172 NM_000059.3:c.2957dupA
+#157:4190 NM_000059.3:c.3067_3071delAACAT
+#160:4164 BRCA2:p.Q1037*
+#159:4169 NM_000059.3:c.3160_3163delGATA
+#157:4195 NM_000059.3:c.3170_3174delAGAAA
+#160:4169 NM_000059.3:c.3195_3198delTAAT
+#160:4170 NM_000059.3:c.3248delA
+#158:4183 NM_000059.3:c.3270delG
+#160:4173 NM_000059.3:c.3354delA
+#160:4175 BRCA2:p.L1152*
+#158:4188 NM_000059.3:c.3500_3501delTA
+#158:4189 NM_000059.3:c.3599_3600delGT
+#159:4182 NM_000059.3:c.3685delG
+#159:4183 NM_000059.3:c.36dupT
+#157:4209 NM_000059.3:c.3744_3747delTGAG
+#157:4211 BRCA2:p.S1271*
+#157:4212 NM_000059.3:c.3859_3860delAA
+#158:4197 BRCA2:p.Q1291*
+#160:4187 NM_000059.3:c.3919delG
+#160:4189 NM_000059.3:c.3939delC
+#159:4194 BRCA2:p.E1320*
+#157:4220 BRCA2:p.L1334*
+#157:4221 NM_000059.3:c.4019delA
+#157:4222 NM_000059.3:c.4076delC
+#159:4199 BRCA2:p.K1367*
+#157:4225 NM_000059.3:c.4130delA
+#157:4226 NM_000059.3:c.4169delT
+#159:4203 BRCA2:p.Q1408*
+#160:4201 NM_000059.3:c.4284dupT
+#158:4214 NM_000059.3:c.4339delG
+#158:4215 NM_000059.3:c.4409_4413delTAAGA
+#159:4208 NM_000059.3:c.4456_4459delGTTA
+#160:4206 BRCA2:p.Q1509*
+#157:4235 NM_000059.3:c.4556delC
+#159:4212 NM_000059.3:c.4630_4631insG
+#158:4222 BRCA2:p.E1550*
+#159:4215 NM_000059.3:c.470_474delAGTCA
+#159:4216 NM_000059.3:c.475+1G>A
+#160:4214 NM_000059.3:c.476-2A>G
+#157:4243 NM_000059.3:c.4821_4823delinsC
+#159:4220 NM_000059.3:c.4876_4877delAA
+#158:4230 BRCA2:p.K1645*
+#159:4223 BRCA2:p.Y1655*
+#160:4221 NM_000059.3:c.5035delA
+#160:4222 NM_000059.3:c.5073delA
+#157:4251 NM_000059.3:c.5130_5133delTGTA
+#157:4252 NM_000059.3:c.51_52delAC
+#159:4229 NM_000059.3:c.517-1G>A
+#157:4255 NM_000059.3:c.5180delA
+#157:4256 NM_000059.3:c.5217_5221delTTTAA
+#158:4241 NM_000059.3:c.5219_5220dupTA
+#160:4231 BRCA2:p.Y1749*
+#158:4244 BRCA2:p.Y1757*
+#157:4262 NM_000059.3:c.5297delA
+#159:4239 NM_000059.3:c.5350_5351delAA
+#160:4237 BRCA2:p.Q1802*
+#157:4266 NM_000059.3:c.5446dupA
+#160:4240 NM_000059.3:c.5482_5486delAAATT
+#158:4253 BRCA2:p.E1857*
+#159:4246 NM_000059.3:c.5585_5588delTGAA
+#160:4244 NM_000059.3:c.5616_5620delAGTAA
+#160:4246 BRCA2:p.C1885*
+#160:4248 NM_000059.3:c.5717_5718delAC
+#160:4249 NM_000059.3:c.5724delA
+#157:4278 NM_000059.3:c.5778_5779delTG
+#159:4255 NM_000059.3:c.5799_5802delCCAA
+#160:4253 NM_000059.3:c.5823delA
+#158:4266 NM_000059.3:c.5851_5854delAGTT
+#159:4259 NM_000059.3:c.5863delT
+#157:4285 BRCA2:p.S1970*
+#159:4262 NM_000059.3:c.5954_5955delCT
+#157:4288 BRCA2:p.Q1994*
+#158:4273 BRCA2:p.Q2009*
+#159:4266 NM_000059.3:c.6059_6062delAACA
+#157:4292 NM_000059.3:c.6071delA
+#157:4293 NM_000059.3:c.6096dupT
+#158:4278 NM_000059.3:c.6154delT
+#159:4271 NM_000059.3:c.6198_6199delTT
+#160:4269 NM_000059.3:c.6209_6212delAAAG
+#157:4298 BRCA2:p.L2080*
+#157:4299 NM_000059.3:c.6277delC
+#158:4284 NM_000059.3:c.631+1G>A
+#160:4274 NM_000059.3:c.632-1G>C
+#160:4275 NM_000059.3:c.6340_6343delCCAG
+#160:4276 NM_000059.3:c.6373delA
+#157:4305 NM_000059.3:c.6393delA
+#158:4290 NM_000059.3:c.6405_6409delCTTAA
+#158:4291 NM_000059.3:c.6444_6447delTATT
+#158:4292 NM_000059.3:c.6447delT
+#159:4285 NM_000059.3:c.6486_6489delACAA
+#160:4283 NM_000059.3:c.6528_6535dupCATTCATG
+#158:4296 BRCA2:p.K2188*
+#160:4286 NM_000059.3:c.6591delT
+#160:4287 NM_000059.3:c.6626_6627delTA
+#160:4288 NM_000059.3:c.6643delT
+#158:4301 NM_000059.3:c.6658_6661delGAAA
+#158:4302 NM_000059.3:c.6678delA
+#159:4295 NM_000059.3:c.67+2T>A
+#159:4296 NM_000059.3:c.6757_6758delCT
+#157:4322 NM_000059.3:c.6809delG
+#157:4323 NM_000059.3:c.682-2A>G
+#159:4300 NM_000059.3:c.692_704dupGCTATTTTTCCAA
+#160:4298 BRCA2:p.R2318*
+#160:4299 NM_000059.3:c.7007+1G>A
+#160:4301 NM_000059.3:c.7008-1G>A
+#157:4330 BRCA2:p.Q2342*
+#158:4315 NM_000059.3:c.7109_7110delAA
+#160:4305 NM_000059.3:c.7151_7152delAA
+#157:4334 NM_000059.3:c.7211_7212delAA
+#158:4319 NM_000059.3:c.7254_7255delAG
+#160:4309 BRCA2:p.R245*
+#157:4338 NM_000059.3:c.7379_7382delACAA
+#157:4339 NM_000059.3:c.7436-2A>T
+#159:4316 BRCA2:p.R2494*
+#160:4314 NM_000059.3:c.755_758delACAG
+#158:4327 NM_000059.3:c.756_759delCAGT
+#158:4328 NM_000059.3:c.7594_7595insTT
+#158:4329 NM_000059.3:c.7617+2T>G
+#159:4322 NM_000059.3:c.7664_7665insC
+#157:608 BRCA2:p.Q2561*
+#158:4333 BRCA2:p.Q258*
+#158:4335 NM_000059.3:c.7761delC
+#158:4336 NM_000059.3:c.7762delA
+#158:4337 NM_000059.3:c.7806-1G>T
+#159:4330 BRCA2:p.W2619*
+#159:5420 BRCA2:p.I2627F
+#157:4358 NM_000059.3:c.7921_7926delinsAG
+#157:4359 NM_000059.3:c.7934delG
+#160:4333 NM_000059.3:c.7976+1G>A
+#157:40 BRCA2:p.E2663V
+#160:4336 NM_000059.3:c.8021delA
+#157:4366 NM_000059.3:c.8042_8043delCA
+#158:4351 NM_000059.3:c.8068_8069delGT
+#157:4369 BRCA2:p.S270*
+#159:4346 NM_000059.3:c.8172_8175dupGTGG
+#158:4356 NM_000059.3:c.8237_8238delCA
+#160:4346 NM_000059.3:c.8331+1G>T
+#160:4347 NM_000059.3:c.8394_8396delinsAA
+#159:4352 NM_000059.3:c.8463delT
+#160:4350 NM_000059.3:c.8488-9T>G
+#160:4352 NM_000059.3:c.8505delA
+#158:4365 NM_000059.3:c.8540delAinsTTC
+#160:4355 BRCA2:p.Q2859*
+#159:4360 BRCA2:p.L2865*
+#160:4358 NM_000059.3:c.8673_8674delAA
+#157:4387 NM_000059.3:c.8713_8716delTATG
+#160:4361 NM_000059.3:c.8755-1G>A
+#158:4374 NM_000059.3:c.8789delA
+#160:4364 NM_000059.3:c.8900delC
+#157:4393 BRCA2:p.S2978*
+#158:4378 NM_000059.3:c.8954-1_8955delinsAA
+#158:4379 NM_000059.3:c.896_897insC
+#157:4397 BRCA2:p.L3000*
+#159:4374 NM_000059.3:c.9026_9030delATCAT
+#160:4372 NM_000059.3:c.9057delA
+#157:4401 NM_000059.3:c.9097delA
+#158:4386 NM_000059.3:c.9117+1G>A
+#160:4376 BRCA2:p.Q3050*
+#158:4389 BRCA2:p.L3061*
+#160:4379 NM_000059.3:c.9253dupA
+#158:4392 NM_000059.3:c.9257-1G>C
+#157:4410 BRCA2:p.Y3098*
+#160:4384 BRCA2:p.W3106*
+#158:4397 NM_000059.3:c.937dupT
+#157:4415 NM_000059.3:c.9401delG
+#157:4416 NM_000059.3:c.9431delC
+#159:4393 BRCA2:p.K3161*
+#157:4419 NM_000059.3:c.9507delT
+#158:4404 BRCA2:p.S3200*
+#159:4397 NM_000059.3:c.9672dupA
+#157:4423 NM_000059.3:c.9690dupA
+#159:4400 BRCA2:p.Y3308*
+#160:4398 NM_000059.3:c.994delA
+#158:4411 NM_032043.2:c.1510dupA
+#160:43 BRIP1:p.R798*
+#157:4430 NM_005188.3:c.1687_1689delinsGG
+#157:4432 NM_004360.3:c.1064dupT
+#159:2424 CDH1:p.R598*
+#159:4411 CDH1:p.Y755*
+#160:4409 NM_004360.3:c.377delC
+#160:5227 CDK4:p.R24C
+#160:4413 NM_000077.4:c.164delG
+#157:4443 NM_000077.4:c.225_243delCGCCACTCTCACCCGACCC
+#157:4445 NM_000077.4:c.243_244delinsT
+#160:4419 NM_000077.4:c.30_47delinsCA
+#158:4432 NM_000077.4:c.407delG
+#158:2762 CDKN2A:p.R24P
+#157:4452 NM_007194.3:c.1461+1G>T
+#159:54 CHEK2:p.R145W
+#159:4430 DICER1:p.Q301*
+#159:969 EGFR:p.G719C
+#160:4430 NM_005228.3:c.2236_2248delinsATTC
+#158:4443 NM_005228.3:c.2236_2252delinsAGAGCAAG
+#159:4436 NM_005228.3:c.2237_2257delinsTCT
+#157:4462 NM_005228.3:c.2240_2257delTAAGAGAAGCAACATCTC
+#157:1807 EGFR:p.S768I
+#160:4438 NM_005228.3:c.2311delAinsGGCACAC
+#160:907 EGFR:p.C797S
+#158:4454 EPCAM:p.M1R
+#158:4456 NM_004456.4:c.1184delG
+#160:4447 EZH2:p.W60*
+#159:4453 EZH2:p.E22*
+#158:4463 NM_000143.3:c.1293delA
+#159:4456 NM_000143.3:c.939delA
+#160:3482 FLCN:p.R527*
+#158:4467 NM_144997.5:c.890_893delAAAG
+#158:4469 GATA2:p.W306*
+#160:4459 NM_000222.2:c.1650_1676delACCCATGTATGAAGTACAGTGGAAGGT
+#158:4472 NM_000222.2:c.1653_1677delinsTTCC
+#160:4462 NM_000222.2:c.1657_1680delinsGTTGTG
+#157:4491 NM_000222.2:c.1663_1668delGTACAG
+#157:4492 NM_000222.2:c.1665_1679delACAGTGGAAGGTTGT
+#158:4477 NM_000222.2:c.1669_1683delTGGAAGGTTGTTGAG
+#159:4470 NM_000222.2:c.1672_1673insTTC
+#160:4468 NM_000222.2:c.1675_1695delGTTGTTGAGGAGATAAATGGA
+#160:1024 KIT:p.V559A
+#158:5288 KIT:p.V560D
+#157:4501 NM_000222.2:c.1708_1728delTACATAGACCCAACACAACTT
+#158:4486 NM_000222.2:c.1727_1729delTTC
+#160:4476 NM_000222.2:c.1739_1740insGACCCAACACAACTTCCTTATGATCCA
+#158:4489 NM_000222.2:c.2045delT
+#160:1020 KIT:p.D816V
+#160:1564 MEN1:p.R465*
+#160:4484 MEN1:p.Y232*
+#159:4489 NM_000245.2:c.3537delA
+#157:4516 MLH1:p.Q346H
+#158:4501 NM_000249.3:c.1190delT
+#159:4494 NM_000249.3:c.1441dupA
+#158:4504 NM_000249.3:c.1559-1G>T
+#158:4506 MLH1:p.L590*
+#160:4496 NM_000249.3:c.1896+1G>A
+#159:4501 MLH1:p.P654L
+#158:4511 MLH1:p.W666*
+#158:4513 NM_000249.3:c.210_213delAGAA
+#157:4531 NM_000249.3:c.2195_2198dupAACA
+#160:4505 NM_000249.3:c.346dupA
+#158:4518 NM_000249.3:c.456_545+2delGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGGCAGGT
+#159:4511 NM_000249.3:c.566delG
+#157:4537 MLH1:p.R226Q
+#159:4514 NM_000249.3:c.67delG
+#158:4524 NM_000249.3:c.816delG
+#157:4542 MSH2:p.W345*
+#159:4519 MSH2:p.Y405=
+#160:4517 NM_000251.2:c.1276+1G>A
+#158:4530 NM_000251.2:c.141_154delCGAGGACGCGCTGC
+#158:4532 NM_000251.2:c.1578delC
+#160:4522 NM_000251.2:c.1760-1G>A
+#158:1041 MSH2:p.A636P
+#158:4537 NM_000251.2:c.2006-2A>G
+#157:4555 NM_000251.2:c.211+1G>T
+#160:4529 NM_000251.2:c.2140delG
+#158:4542 NM_000251.2:c.2423_2424delAA
+#157:4560 NM_000251.2:c.2633_2634delAG
+#158:4545 NM_000251.2:c.475dupA
+#157:4563 NM_000251.2:c.571_573delCTC
+#159:4540 MSH2:p.S281*
+#160:4538 NM_000251.2:c.942+3A>T
+#160:4540 NM_000179.2:c.114dupC
+#158:4553 NM_000179.2:c.1571dupA
+#160:4543 NM_000179.2:c.1982delG
+#159:4548 NM_000179.2:c.2230dupG
+#160:4547 NM_000179.2:c.2677_2678delCT
+#160:4549 MSH6:p.R1005*
+#158:4563 MSH6:p.S1028*
+#157:4581 NM_000179.2:c.3163dupG
+#159:4558 NM_000179.2:c.3260_3261dupCC
+#160:4556 NM_000179.2:c.3311_3312delTT
+#157:4585 NM_000179.2:c.3439-2A>G
+#157:4586 NM_000179.2:c.3513_3514delTA
+#160:4560 NM_000179.2:c.3573dupT
+#158:4573 NM_000179.2:c.3847_3850dupATTA
+#159:4566 NM_000179.2:c.3959_3962delCAAG
+#159:4567 NM_000179.2:c.4001+1delG
+#159:4569 NM_000179.2:c.578delT
+#159:606 MSH6:p.R240*
+#158:4581 MUTYH:p.S346=
+#159:4575 NM_001128425.1:c.1227_1228dupGG
+#160:4574 NM_001128425.1:c.596delG
+#158:4588 MUTYH:p.G286E
+#160:4578 NM_002485.4:c.657_661delACAAA
+#158:4591 NF1:p.Q400*
+#157:4609 NM_001042492.2:c.154delT
+#160:4584 NM_001042492.2:c.1845+1G>T
+#157:4614 NF1:p.E800*
+#160:4589 NF1:p.Q950*
+#160:4591 NM_001042492.2:c.338dupT
+#157:2476 NF1:p.R1241*
+#157:4624 NF1:p.Q1360*
+#160:4599 NF1:p.W1559*
+#158:2475 NF1:p.R1769*
+#160:4604 NM_001042492.2:c.5833delT
+#159:4610 NF1:p.R2119*
+#160:4609 NM_001042492.2:c.6855_6856delCA
+#160:4611 NM_001042492.2:c.7615_7615+1delinsAGTTAT
+#157:4641 NF1:p.K2652*
+#159:4619 NM_024675.3:c.1032_1033dupCT
+#160:4617 NM_024675.3:c.1317delG
+#158:4630 NM_024675.3:c.172_175delTTGT
+#158:4632 NM_024675.3:c.2160_2161insG
+#160:4622 PALB2:p.Q775*
+#159:4627 PALB2:p.W906*
+#157:4653 NM_024675.3:c.2964delA
+#160:4628 PALB2:p.R1086*
+#159:4633 NM_024675.3:c.487_488delGT
+#160:5253 PDGFRA:p.V561D
+#157:4661 NM_000535.5:c.1076dupT
+#158:4647 PMS2:p.R469*
+#160:4637 NM_000535.5:c.164-9_178delinsGATCC
+#158:4651 PMS2:p.K647*
+#159:4644 NM_000535.5:c.2275+1G>A
+#160:4642 NM_000535.5:c.251-2A>T
+#160:4644 NM_000535.5:c.593dupT
+#158:4657 NM_000535.5:c.861_864delACAG
+#157:2886 PTEN:p.R335*
+#157:4677 NM_000314.4:c.270delT
+#158:4663 NM_000314.4:c.39_40delAA
+#159:4657 NM_000314.4:c.491dupA
+#157:232 PTEN:p.R233*
+#158:4670 NM_000314.4:c.820delT
+#160:4661 NM_000314.4:c.955_958delACTT
+#157:1985 PTPN11:p.E76A
+#158:4677 RAD51C:p.Y209*
+#159:4670 NM_002878.3:c.772_778delGGGAGGC
+#160:4668 RET:p.C609R
+#160:4670 RET:p.C620S
+#160:186 RET:p.C634R
+#160:187 RET:p.L790F
+#159:4679 NM_001754.4:c.1159_1168dupGGCTCGTCGC
+#158:4689 NM_001754.4:c.301delG
+#159:4683 NM_001754.4:c.369dupT
+#160:4682 RUNX1:p.R166*
+#158:4696 NM_001754.4:c.709delA
+#158:4698 NM_004168.3:c.1460dupA
+#157:4717 SDHA:p.E164*
+#157:4719 NM_003000.2:c.201_286delATGTGGCCCCATGGTATTGGATGCTTTAATCAAGATTAAGAATGAAGTTGACTCTACTTTGACCTTCCGAAGATCATGCAGAGAAG
+#157:193 SDHB:p.I127S
+#158:4706 NM_003001.3:c.405+1G>A
+#159:4700 SDHD:p.P81L
+#157:4726 NM_003002.2:c.314+1G>A
+#158:4712 NM_005359.5:c.112dupA
+#158:4714 NM_005359.5:c.1245_1248delCAGA
+#159:4708 NM_005359.5:c.1351_1375delGCGGCTACTGCACAAGCTGCAGCAG
+#160:4707 NM_005359.5:c.517_527delTCCACTGAAGG
+#158:3148 SMAD4:p.Q245*
+#158:4723 SMARCA4:p.Q575*
+#157:4741 NM_000455.4:c.119delG
+#159:4719 STK11:p.S69*
+#157:4746 NM_000455.4:c.387_388delinsTT
+#159:4724 STK11:p.E165*
+#159:4726 NM_000455.4:c.619delG
+#157:4753 NM_000455.4:c.735-2A>T
+#157:4755 NM_000455.4:c.804delG
+#159:5397 TP53:p.R337C
+#160:4732 NM_000546.5:c.1024delC
+#157:4762 NM_000546.5:c.107delC
+#158:3294 TP53:p.W53*
+#159:4742 NM_000546.5:c.216delC
+#159:4744 NM_000546.5:c.245delC
+#159:4746 NM_000546.5:c.277_293delCTGTCATCTTCTGTCCC
+#160:4745 NM_000546.5:c.287_288delCT
+#160:4747 NM_000546.5:c.314delG
+#160:4749 NM_000546.5:c.325_326delTT
+#157:4779 NM_000546.5:c.375+2T>C
+#160:4753 NM_000546.5:c.389_393delTCAAC
+#157:4783 NM_000546.5:c.421_424delTGCC
+#158:4769 NM_000546.5:c.425delC
+#160:4760 NM_000546.5:c.448_460delACACCCCCGCCCG
+#157:4790 NM_000546.5:c.455delC
+#157:4792 NM_000546.5:c.466_472delCGCGTCC
+#158:4778 NM_000546.5:c.475_476delGC
+#158:4780 NM_000546.5:c.499_500delCA
+#160:1119 TP53:p.R175H
+#157:4801 NM_000546.5:c.560-22_560delATTCCTCACTGATTGCTCTTAGG
+#160:213 TP53:p.I195T
+#159:4781 TP53:p.L201*
+#159:2376 TP53:p.R213*
+#157:221 TP53:p.Y220S
+#160:4784 NM_000546.5:c.685dupT
+#160:4786 NM_000546.5:c.704delA
+#160:5384 TP53:p.C242S
+#157:2018 TP53:p.G245D
+#159:4797 NM_000546.5:c.747delGinsTT
+#159:4799 TP53:p.E258*
+#158:4809 NM_000546.5:c.80delC
+#159:4803 NM_000546.5:c.831_837delTCCTGGG
+#157:4830 TP53:p.E286*
+#158:4816 NM_000546.5:c.868_871delCGCA
+#158:4818 NM_000546.5:c.879_880delinsTT
+#159:4812 NM_000546.5:c.902delC
+#159:4814 NM_000546.5:c.91delG
+#157:4841 NM_000546.5:c.968_986dupTGGATGGAGAATATTTCAC
+#157:4843 TP53:p.Q331*
+#159:4820 NM_000548.3:c.4375delC
+#160:4818 NM_000551.3:c.390_391delTA
+#157:4847 NM_024426.3:c.1105_1109dupCGACG
+#160:4821 NM_024426.3:c.786_787insCAAG
+#160:4823 NM_000038.4:c.1820_1821delinsAG
+#159:4828 NM_000059.3:c.1454delAinsTGTATT
+#160:4826 NM_000059.3:c.7494_7496delinsG
+#160:4827 NM_000222.2:c.1648-3_1673delCAGAAACCCATGTATGAAGTACAGTGGAA
+#159:4832 NM_000251.2:c.942+2_942+6delTAAAA
+#157:4858 NM_000314.4:c.562_565dupTATA
+#158:4843 NM_000546.5:c.270delC
+#160:1576 APC:p.Q358*
+#158:3726 APC:p.W421*
+#157:3744 NM_000038.4:c.1354_1355dupGT
+#160:3718 APC:p.Q473*
+#158:3291 APC:p.R499*
+#157:3750 NM_000038.4:c.1620dupA
+#158:2245 APC:p.W553*
+#160:3727 NM_000038.4:c.1742delA
+#158:3741 APC:p.W593*
+#159:3735 NM_000038.4:c.1886dupT
+#159:3737 NM_000038.4:c.2121delCinsAAA
+#160:3736 APC:p.E761*
+#158:3750 NM_000038.4:c.2387_2388delAT
+#159:3744 NM_000038.4:c.2486_2487delCA
+#160:3743 NM_000038.4:c.2527_2530delAGTT
+#160:3745 NM_000038.4:c.2547_2548delTA
+#159:3751 APC:p.Q901*
+#160:3750 APC:p.K939*
+#158:3764 APC:p.Y96*
+#159:3758 NM_000038.4:c.3077delA
+#157:3785 NM_000038.4:c.3202_3205delTCAA
+#159:3763 APC:p.R1114=
+#160:3762 APC:p.E1145*
+#160:3764 APC:p.Q1175*
+#159:3769 NM_000038.4:c.3595_3596delAA
+#158:3779 NM_000038.4:c.3690_3700delinsC
+#160:3769 APC:p.E1286*
+#160:3771 NM_000038.4:c.3878delC
+#157:3801 NM_000038.4:c.3892_3902delTCTGCTAATAC
+#158:440 APC:p.E1306*
+#158:3789 NM_000038.4:c.3927_3931delAAAGA
+#158:1544 APC:p.Q1328*
+#157:3810 APC:p.K1350*
+#158:3796 APC:p.G1357*
+#159:3790 NM_000038.4:c.4127_4128delAT
+#159:3792 NM_000038.4:c.4170delC
+#157:3819 NM_000038.4:c.4206delC
+#157:3821 APC:p.R141S
+#160:3795 NM_000038.4:c.4271delC
+#157:3825 NM_000038.4:c.4316_4319delCTCC
+#158:3811 NM_000038.4:c.4359delT
+#158:3813 NM_000038.4:c.4415delT
+#158:3815 NM_000038.4:c.4473dupT
+#158:3817 NM_000038.4:c.4573delA
+#158:3819 NM_000038.4:c.4666dupA
+#157:3837 APC:p.Q163*
+#158:3822 NM_000038.4:c.5145delC
+#157:3840 NM_000038.4:c.5854_5860delCAGAATT
+#157:3843 APC:p.K226*
+#160:3287 APC:p.R283*
+#159:1342 APC:p.R302*
+#158:3834 NM_000051.3:c.1914_1929dupAGATAAAGAAGAACTT
+#160:3824 NM_000051.3:c.2502dupA
+#157:3853 NM_000051.3:c.3245_3247delinsTGAT
+#158:3838 NM_000051.3:c.4098_4099delTG
+#157:3856 ATM:p.R1898*
+#159:3833 ATM:p.K1964*
+#160:1821 ATM:p.V2424G
+#160:3833 ATM:p.R2598*
+#160:3834 NM_000051.3:c.8052_8055delGTCA
+#158:3847 NM_000051.3:c.864delT
+#159:2613 BLM:p.R899*
+#159:3842 BMPR1A:p.R228*
+#157:3868 NM_007294.3:c.1018delG
+#157:3870 BRCA1:p.E352*
+#160:3844 NM_007294.3:c.1072delC
+#160:3845 NM_007294.3:c.1088delA
+#158:3858 NM_007294.3:c.1121_1123delinsT
+#159:3851 BRCA1:p.K381*
+#159:3852 NM_007294.3:c.1175_1214delTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC
+#158:3862 NM_007294.3:c.1232_1233delAT
+#159:3855 NM_007294.3:c.1255delG
+#157:3881 NM_007294.3:c.1297delG
+#159:3858 NM_007294.3:c.1319delT
+#160:3856 NM_007294.3:c.1335_1336delAA
+#160:3857 NM_007294.3:c.134+2T>C
+#160:3858 NM_007294.3:c.135-2A>G
+#158:3871 NM_007294.3:c.1383delT
+#158:3872 NM_007294.3:c.1389_1390delinsG
+#160:3862 NM_007294.3:c.139dupT
+#158:3875 NM_007294.3:c.143delT
+#158:3876 NM_007294.3:c.144delG
+#157:3894 NM_007294.3:c.1492delC
+#159:3871 NM_007294.3:c.1505_1509delTAAAG
+#159:3872 NM_007294.3:c.1518delG
+#160:3870 NM_007294.3:c.1551delT
+#157:3899 NM_007294.3:c.1583_1589delCTCCTGA
+#160:3873 BRCA1:p.Q541*
+#157:3902 NM_007294.3:c.1649delA
+#158:3887 NM_007294.3:c.171delG
+#159:3880 NM_007294.3:c.1757delC
+#157:3906 BRCA1:p.E597*
+#160:3880 NM_007294.3:c.1_80delATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTG
+#159:3885 NM_007294.3:c.1823_1826delAGAA
+#157:3911 BRCA1:p.K614*
+#159:3888 NM_007294.3:c.1893_1894insT
+#157:3914 BRCA1:p.L639*
+#159:3891 NM_007294.3:c.19_47delCGCGTTGAAGAAGTACAAAATGTCATTAA
+#159:3892 NM_007294.3:c.195delG
+#160:3890 NM_007294.3:c.1961dupA
+#158:3903 NM_007294.3:c.2017delG
+#160:3893 NM_007294.3:c.2038_2039insCC
+#157:3922 NM_007294.3:c.2074delC
+#158:3907 NM_007294.3:c.2110_2111delAA
+#159:3900 NM_007294.3:c.212+1G>T
+#160:3898 NM_007294.3:c.213-11T>G
+#157:3927 BRCA1:p.S713*
+#160:3901 NM_007294.3:c.2176delC
+#158:3914 BRCA1:p.E732*
+#158:3915 NM_007294.3:c.2203delC
+#159:3908 NM_007294.3:c.2210delC
+#160:3906 NM_007294.3:c.2217dupA
+#160:3907 NM_007294.3:c.2263delG
+#158:3920 NM_007294.3:c.2283_2284delAA
+#160:3910 BRCA1:p.S770*
+#157:3939 NM_007294.3:c.232delA
+#159:3916 NM_007294.3:c.2351_2357delCGTTACT
+#160:3914 BRCA1:p.E797*
+#157:3943 BRCA1:p.C801*
+#158:3928 NM_007294.3:c.2411_2412delAG
+#160:3918 NM_007294.3:c.2443delA
+#160:3919 NM_007294.3:c.2475delC
+#160:3920 NM_007294.3:c.2487delT
+#160:3921 NM_007294.3:c.2517_2518delCA
+#159:3926 BRCA1:p.Y856*
+#157:3952 NM_007294.3:c.2611_2612delCC
+#158:3937 BRCA1:p.E879*
+#159:3930 NM_007294.3:c.2658_2659insA
+#159:3931 NM_007294.3:c.2681_2682delAA
+#159:3932 NM_007294.3:c.2702_2703delTT
+#157:3958 BRCA1:p.E908*
+#157:3959 NM_007294.3:c.2727_2730delTCAA
+#159:3937 BRCA1:p.E914*
+#160:3935 NM_007294.3:c.2762delA
+#160:3936 NM_007294.3:c.2796_2799delTGGT
+#157:3965 NM_007294.3:c.2812_2813delinsG
+#159:3942 NM_007294.3:c.2834_2836delinsC
+#160:3940 NM_007294.3:c.2868delT
+#157:3969 NM_007294.3:c.2889_2890delTG
+#157:3970 NM_007294.3:c.2920_2921delTT
+#160:3944 BRCA1:p.Y978*
+#160:3945 NM_007294.3:c.2980delT
+#157:3974 NM_007294.3:c.2999delA
+#157:3975 NM_007294.3:c.3018_3021delTTCA
+#158:3960 NM_007294.3:c.302-2A>C
+#159:3953 BRCA1:p.S1009*
+#157:3979 BRCA1:p.E1017*
+#158:3964 NM_007294.3:c.3107_3112delTTAAAG
+#160:3954 BRCA1:p.E1060*
+#160:3955 NM_007294.3:c.3194_3195insG
+#160:3956 NM_007294.3:c.321delT
+#157:3985 BRCA1:p.L1080*
+#159:3962 BRCA1:p.L1086*
+#158:3972 NM_007294.3:c.3288_3289delAA
+#158:3973 NM_007294.3:c.329dupA
+#157:3991 NM_007294.3:c.3323_3326delTAAA
+#157:3992 NM_007294.3:c.3330_3331insA
+#159:3969 BRCA1:p.Y1113*
+#157:3995 NM_007294.3:c.3357delT
+#157:3996 NM_007294.3:c.3365_3366delCA
+#158:3981 NM_007294.3:c.3397_3398delTT
+#157:3999 NM_007294.3:c.3407delC
+#159:3976 BRCA1:p.Q1144*
+#159:3977 NM_007294.3:c.3477_3480delAAAG
+#160:3975 NM_007294.3:c.3531delT
+#157:4004 NM_007294.3:c.3569_3570delCT
+#158:3989 BRCA1:p.Q1200*
+#160:3979 NM_007294.3:c.3626delT
+#157:4008 NM_007294.3:c.3642_3643delGA
+#159:3985 BRCA1:p.E1222*
+#157:4011 BRCA1:p.L1230*
+#158:3996 NM_007294.3:c.3706_3713delAATATACC
+#159:3989 NM_007294.3:c.3722_3740delCTACTAGGCATAGCACCGT
+#160:3987 NM_007294.3:c.3756_3759delGTCT
+#160:3988 NM_007294.3:c.3761_3762insTT
+#159:682 BRCA1:p.E1258*
+#159:3994 BRCA1:p.S1262*
+#160:3992 NM_007294.3:c.3839_3843delinsAGGC
+#157:4021 NM_007294.3:c.3858_3861delTGAG
+#158:4006 NM_007294.3:c.3869_3870delAA
+#157:4024 BRCA1:p.E1302*
+#159:4001 NM_007294.3:c.3931_3934delAACA
+#157:4027 NM_007294.3:c.3966delA
+#158:4012 NM_007294.3:c.399_400delTG
+#160:4002 NM_007294.3:c.4038_4039delAA
+#158:4015 NM_007294.3:c.4065_4068delTCAA
+#160:4005 NM_007294.3:c.4096+1G>A
+#160:4006 NM_007294.3:c.4111_4112insATCT
+#157:4035 NM_007294.3:c.4120_4121delAG
+#158:4020 NM_007294.3:c.4128_4129delAA
+#160:4010 NM_007294.3:c.4163_4166delAGAG
+#157:4039 BRCA1:p.Q1395*
+#158:4024 NM_007294.3:c.4186_4357dupCAGAGGGATACCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAG
+#159:4017 NM_007294.3:c.4214delT
+#157:4043 NM_007294.3:c.4243delG
+#159:4020 NM_007294.3:c.4285_4286insG
+#159:4022 BRCA1:p.Q1447*
+#159:4023 NM_007294.3:c.4357+2T>G
+#157:4049 NM_007294.3:c.4373_4389delAGAAAAGTAGTGAATAC
+#159:4026 NM_007294.3:c.4391_4403delinsTT
+#157:4052 NM_007294.3:c.4416_4417delinsG
+#159:4029 NM_007294.3:c.4484+1G>A
+#157:4055 NM_007294.3:c.4485-2A>G
+#157:4057 BRCA1:p.W1508*
+#159:4034 BRCA1:p.Q1525*
+#159:4036 BRCA1:p.Q1537*
+#158:4046 BRCA1:p.E1541*
+#160:4036 BRCA1:p.Q1556*
+#158:2950 BRCA1:p.E1559K
+#160:4039 BRCA1:p.G1560*
+#157:4068 NM_007294.3:c.4745delA
+#158:4053 BRCA1:p.K1601*
+#157:4071 BRCA1:p.A1623G
+#157:4072 NM_007294.3:c.4944_4945delAA
+#158:4057 NM_007294.3:c.4966_4984delGGCCTGACCCCAGAAGAAT
+#159:4050 NM_007294.3:c.4986+4A>C
+#160:4048 NM_007294.3:c.4987_5074delATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAG
+#157:4077 NM_007294.3:c.5030_5033delCTAA
+#157:1615 BRCA1:p.E1683*
+#160:4052 NM_007294.3:c.5074+2T>C
+#160:2735 BRCA1:p.D1692Y
+#159:4058 NM_007294.3:c.5075-2A>T
+#160:2743 BRCA1:p.R1699W
+#160:4058 BRCA1:p.Y1703*
+#159:4063 BRCA1:p.W1712*
+#158:4073 BRCA1:p.Q172*
+#158:4074 NM_007294.3:c.5152+1G>C
+#158:4075 NM_007294.3:c.5153-1G>C
+#160:4065 NM_007294.3:c.5156_5157delTG
+#158:4078 NM_007294.3:c.5177_5178delGA
+#159:4071 NM_007294.3:c.5193+2delT
+#159:4072 NM_007294.3:c.5194-2A>G
+#157:4098 BRCA1:p.R1737*
+#160:4072 BRCA1:p.Q1747*
+#157:2627 BRCA1:p.R1751*
+#160:4075 NM_007294.3:c.5266dupC
+#157:4104 NM_007294.3:c.5277+1dupG
+#159:4081 NM_007294.3:c.5278-1G>T
+#160:4079 NM_007294.3:c.529delT
+#160:4080 NM_007294.3:c.5311_5332+1delCCCTTCACCAACATGCCCACAGG
+#157:4109 NM_007294.3:c.5332+2T>A
+#158:4094 NM_007294.3:c.5341delG
+#158:4096 NM_007294.3:c.5370_5397delTGTGGTGAAGGAGCTTTCATCATTCACC
+#159:4089 NM_007294.3:c.5406+2delT
+#159:4090 NM_007294.3:c.5407-2A>T
+#160:4088 BRCA1:p.W1815*
+#158:4101 NM_007294.3:c.5467+2T>G
+#158:4102 NM_007294.3:c.547+1G>T
+#158:4103 NM_007294.3:c.5496_5506delinsA
+#160:4093 BRCA1:p.E1836*
+#159:4098 BRCA1:p.Y1845*
+#159:4100 NM_007294.3:c.64_65delTT
+#157:4126 NM_007294.3:c.66dupA
+#157:4127 NM_007294.3:c.685delT
+#158:4112 NM_007294.3:c.70_71insTGTC
+#159:4105 BRCA1:p.E255*
+#160:4103 NM_007294.3:c.794_795delCT
+#157:4132 NM_007294.3:c.81_134delTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA
+#159:4109 NM_007294.3:c.81-2delA
+#160:4107 NM_007294.3:c.83_84delTG
+#157:4136 NM_007294.3:c.851_852delAG
+#158:4121 NM_007294.3:c.902_903insT
+#158:4122 NM_007294.3:c.929delA
+#160:4112 NM_007294.3:c.952_1015delCATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAA
+#157:4141 NM_007294.3:c.980_981delCA
+#158:4126 NM_000059.3:c.1029delA
+#160:4116 NM_000059.3:c.1128delT
+#157:4145 NM_000059.3:c.1188_1189insTTAG
+#158:4130 NM_000059.3:c.1225delG
+#159:4123 BRCA2:p.Q421*
+#159:4124 NM_000059.3:c.1293delA
+#159:4125 NM_000059.3:c.1389_1390delAG
+#159:4127 BRCA2:p.Q486*
+#160:4125 NM_000059.3:c.1511_1512delCT
+#157:4154 NM_000059.3:c.1595_1599delAAACT
+#157:4155 NM_000059.3:c.1631_1632delCT
+#160:4129 BRCA2:p.W563*
+#157:4158 NM_000059.3:c.1754delA
+#158:4143 BRCA2:p.E597*
+#160:4133 NM_000059.3:c.1813dupA
+#160:4135 BRCA2:p.S611*
+#157:4164 NM_000059.3:c.1889delC
+#159:4141 BRCA2:p.Q649*
+#157:4167 NM_000059.3:c.2049_2050delTC
+#159:4144 NM_000059.3:c.2085_2089delGGAAA
+#159:4145 NM_000059.3:c.2103_2106delTATT
+#157:4171 NM_000059.3:c.2287delC
+#157:4173 BRCA2:p.Y792*
+#160:4147 NM_000059.3:c.2442delC
+#157:4176 BRCA2:p.Q84*
+#160:4150 NM_000059.3:c.2545delG
+#157:4179 NM_000059.3:c.2589delT
+#159:4156 NM_000059.3:c.2622dupT
+#159:4157 NM_000059.3:c.266delC
+#159:4158 NM_000059.3:c.2743_2747delACTTG
+#160:4156 NM_000059.3:c.2798delC
+#160:4157 NM_000059.3:c.2812_2815delGCAA
+#158:4170 NM_000059.3:c.2834_2835delAA
+#159:4163 NM_000059.3:c.2899_2900delCT
+#160:4161 BRCA2:p.W993*
+#158:4174 NM_000059.3:c.3075_3076delinsTT
+#157:4192 NM_000059.3:c.3146delA
+#160:4166 NM_000059.3:c.316+2T>C
+#159:4171 NM_000059.3:c.317-2A>G
+#157:4197 NM_000059.3:c.3199delA
+#158:4182 NM_000059.3:c.3262_3263delCC
+#160:4172 NM_000059.3:c.3273_3276delATTT
+#158:4185 BRCA2:p.S1121*
+#157:4203 NM_000059.3:c.3458delA
+#159:4180 NM_000059.3:c.3545_3546delTT
+#160:4178 NM_000059.3:c.3639delA
+#160:4179 NM_000059.3:c.3689delC
+#157:4208 NM_000059.3:c.3708delA
+#159:4185 BRCA2:p.E1250*
+#158:4195 NM_000059.3:c.3834_3835delTA
+#158:4196 NM_000059.3:c.3860_3863delATAA
+#160:4186 BRCA2:p.L1294*
+#158:4199 BRCA2:p.E1308*
+#158:4201 BRCA2:p.K1314*
+#157:4219 BRCA2:p.K1323*
+#158:4204 NM_000059.3:c.4005dupA
+#158:4205 NM_000059.3:c.4037_4038delCT
+#158:4206 NM_000059.3:c.407delA
+#160:4196 NM_000059.3:c.410delC
+#158:4209 NM_000059.3:c.4133_4136delCTCA
+#159:4202 BRCA2:p.E1391*
+#157:4228 BRCA2:p.E1415*
+#158:4213 BRCA2:p.Q1429*
+#159:4206 NM_000059.3:c.4398_4402delACATT
+#160:4204 NM_000059.3:c.4415_4418delAGAA
+#160:4205 NM_000059.3:c.4471_4474delCTGA
+#157:4234 NM_000059.3:c.4544dupA
+#159:4211 BRCA2:p.K1530*
+#160:4209 NM_000059.3:c.4631delA
+#159:4214 NM_000059.3:c.4649_4650delAG
+#160:4212 NM_000059.3:c.4712_4713delAG
+#160:4213 NM_000059.3:c.475+1G>T
+#157:4242 NM_000059.3:c.4780delA
+#159:4219 NM_000059.3:c.4829_4830delTG
+#158:3333 BRCA2:p.S1630*
+#159:4222 NM_000059.3:c.4935delA
+#157:4248 NM_000059.3:c.4965delC
+#157:4249 NM_000059.3:c.5042_5043delTG
+#157:4250 NM_000059.3:c.5073dupA
+#158:4235 NM_000059.3:c.5132_5135delTAGG
+#158:4236 NM_000059.3:c.5157_5161delTTCAA
+#160:4226 NM_000059.3:c.517-2A>G
+#158:4239 NM_000059.3:c.518delG
+#158:4240 NM_000059.3:c.5217_5223delTTTAAGT
+#159:4233 NM_000059.3:c.5222_5225delGTAA
+#158:4243 NM_000059.3:c.52_61delCGCTGCAACA
+#157:4261 BRCA2:p.S1760*
+#159:4238 NM_000059.3:c.5303_5304delTT
+#160:4236 NM_000059.3:c.5351delA
+#157:4265 NM_000059.3:c.5410_5411delGT
+#159:4242 NM_000059.3:c.5454delA
+#157:4268 NM_000059.3:c.5526delT
+#159:4245 NM_000059.3:c.5576_5579delTTAA
+#160:4243 NM_000059.3:c.5595_5596delAT
+#157:4272 NM_000059.3:c.5621_5624delTTAA
+#158:4258 BRCA2:p.Q1886*
+#157:4276 NM_000059.3:c.5720_5723delCTCT
+#157:4277 NM_000059.3:c.574_575delAT
+#159:4254 BRCA2:p.E1928*
+#160:4252 NM_000059.3:c.5809_5812delTCTG
+#157:4281 NM_000059.3:c.5827dupT
+#159:4258 NM_000059.3:c.5851_5854dupAGTT
+#157:4284 BRCA2:p.S1955*
+#159:4261 BRCA2:p.C1975*
+#157:4287 BRCA2:p.Q1987*
+#158:4272 NM_000059.3:c.6001delT
+#159:4265 NM_000059.3:c.6034dupT
+#157:4291 BRCA2:p.S2022*
+#158:4276 NM_000059.3:c.6078_6079delAA
+#158:4277 NM_000059.3:c.6103delA
+#159:4270 NM_000059.3:c.6167_6168delCT
+#160:4268 NM_000059.3:c.6201delC
+#157:4297 NM_000059.3:c.6216delC
+#158:4282 NM_000059.3:c.6267_6269delinsC
+#158:4283 NM_000059.3:c.6280_6286delTATTCAC
+#159:4276 NM_000059.3:c.631+2T>G
+#157:4302 NM_000059.3:c.632-2A>G
+#157:4303 NM_000059.3:c.6352_6353delGT
+#157:4304 NM_000059.3:c.6373dupA
+#158:4289 NM_000059.3:c.6399_6417delAAATAACTTAAATGTTGAA
+#159:4282 NM_000059.3:c.6407_6411delTAAAT
+#159:4283 NM_000059.3:c.6445_6446delAT
+#159:4284 NM_000059.3:c.6449_6450delAA
+#157:4310 NM_000059.3:c.6490delC
+#158:4295 BRCA2:p.E218*
+#160:4285 NM_000059.3:c.6566dupA
+#157:4314 NM_000059.3:c.6600_6601delTT
+#157:4315 NM_000059.3:c.6629_6630delAA
+#157:4316 NM_000059.3:c.6644_6647delACTC
+#159:4293 NM_000059.3:c.6658_6662delGAAAA
+#160:4291 BRCA2:p.E2239*
+#160:4292 NM_000059.3:c.67+2T>C
+#160:4293 NM_000059.3:c.6761_6762delTT
+#158:4306 NM_000059.3:c.6816_6817delAA
+#159:4299 NM_000059.3:c.6833_6837delTCTTA
+#160:4297 NM_000059.3:c.6938-2A>G
+#157:4326 NM_000059.3:c.6980delT
+#157:2751 BRCA2:p.R2336H
+#157:4329 NM_000059.3:c.7008-2A>G
+#158:4314 NM_000059.3:c.7025_7026delAA
+#160:4304 BRCA2:p.S2372*
+#158:4317 BRCA2:p.R2394*
+#158:4318 NM_000059.3:c.7226delC
+#160:4308 BRCA2:p.Q2421*
+#157:4337 NM_000059.3:c.7360delA
+#158:4322 NM_000059.3:c.7412_7421delCAAAGTGTGA
+#158:4323 NM_000059.3:c.7443delT
+#160:4313 NM_000059.3:c.748delG
+#158:2449 BRCA2:p.R2520*
+#159:4319 NM_000059.3:c.7567_7568delCT
+#159:4320 NM_000059.3:c.7596_7609delCTCTGCGTGTTCTC
+#159:4321 NM_000059.3:c.7618-1G>A
+#160:4319 NM_000059.3:c.7673_7674delAG
+#157:4348 NM_000059.3:c.7689delC
+#159:4325 NM_000059.3:c.7737_7749delACAGTTGGCTGAT
+#159:4327 NM_000059.3:c.7762_7764delATA
+#159:4328 NM_000059.3:c.778_779delGA
+#159:4329 NM_000059.3:c.7806-2_7806-1dupAG
+#157:4355 BRCA2:p.Y2621*
+#157:4357 BRCA2:p.W2629*
+#158:4342 NM_000059.3:c.793+1G>A
+#158:4343 NM_000059.3:c.7954delG
+#157:42 BRCA2:p.R2659K
+#160:4335 BRCA2:p.R2666*
+#158:1846 BRCA2:p.I2675V
+#158:4350 NM_000059.3:c.8058delT
+#160:4340 BRCA2:p.S2695*
+#158:4353 NM_000059.3:c.8130delT
+#157:4371 BRCA2:p.S273*
+#159:4348 NM_000059.3:c.8247_8248delGA
+#157:4374 NM_000059.3:c.8331+2T>C
+#157:4375 NM_000059.3:c.8395delA
+#160:4349 NM_000059.3:c.8474delC
+#158:4362 BRCA2:p.W2830*
+#158:4364 BRCA2:p.Y2839*
+#159:4357 NM_000059.3:c.8550delA
+#157:4383 NM_000059.3:c.8575delC
+#157:4385 BRCA2:p.E2877*
+#157:4386 NM_000059.3:c.8676delA
+#158:4371 NM_000059.3:c.8749delC
+#157:4389 NM_000059.3:c.8756delG
+#159:4366 NM_000059.3:c.8848delAinsCT
+#157:4392 NM_000059.3:c.8904delC
+#159:4369 BRCA2:p.S2984*
+#159:4370 NM_000059.3:c.8954-3C>G
+#160:4368 BRCA2:p.W2990*
+#159:5418 BRCA2:p.E3002K
+#160:4371 NM_000059.3:c.9027delT
+#157:4400 NM_000059.3:c.9066_9067insAA
+#158:4385 NM_000059.3:c.9097dupA
+#159:4378 NM_000059.3:c.9117+1G>T
+#157:945 BRCA2:p.R3052W
+#160:4378 BRCA2:p.Q3066*
+#157:4407 NM_000059.3:c.9256+1G>A
+#159:4384 NM_000059.3:c.9275_9278delATTT
+#160:4383 BRCA2:p.W31*
+#158:4396 BRCA2:p.L3119*
+#157:4414 BRCA2:p.W3127*
+#158:4399 NM_000059.3:c.9403delC
+#159:4392 NM_000059.3:c.9435_9436delGT
+#157:4418 BRCA2:p.E3167*
+#158:4403 NM_000059.3:c.9513_9516delACTT
+#160:4393 BRCA2:p.Q321*
+#160:4394 NM_000059.3:c.9676delT
+#158:4407 NM_000059.3:c.9699_9702delTATG
+#157:4425 BRCA2:p.E3309*
+#157:4426 NM_032043.2:c.128_131delTGTT
+#160:4400 BRIP1:p.S624*
+#158:4413 BRIP1:p.Q827*
+#158:4414 NM_005188.3:c.56dupG
+#159:4408 NM_004360.3:c.112_136delACGTTCACGGTGCCCCGGCGCCACC
+#157:4434 NM_004360.3:c.2064_2065delTG
+#160:4408 NM_004360.3:c.2311delC
+#158:4421 NM_004360.3:c.377dupC
+#158:4423 NM_000077.4:c.120_136delACCGAATAGTTACGGTC
+#158:4425 NM_000077.4:c.168delC
+#158:4427 NM_000077.4:c.225delC
+#158:4429 NM_000077.4:c.253_273delinsT
+#157:4447 NM_000077.4:c.330_331delinsAA
+#160:4421 NM_000077.4:c.445delG
+#157:4451 NM_007194.3:c.1100delC
+#158:4436 NM_007194.3:c.247delC
+#159:4429 NM_007194.3:c.444+1G>A
+#160:4427 NM_005228.3:c.1921_1935delCCTAAGATCCCGTCC
+#160:66 EGFR:p.G719A
+#158:4442 NM_005228.3:c.2236_2248delinsCAAC
+#159:4435 NM_005228.3:c.2236_2257delinsTCTT
+#160:4433 NM_005228.3:c.2239_2248delinsC
+#158:5255 EGFR:p.D761Y
+#157:4465 NM_005228.3:c.2308_2309insTTG
+#157:4466 NM_005228.3:c.2314_2319dupCCCCAC
+#158:4452 NM_005228.3:c.2573_2574delinsGT
+#160:4443 ETV6:p.W380*
+#157:4473 EZH2:p.E430*
+#159:4451 EZH2:p.C609*
+#159:744 FH:p.R343*
+#159:4455 NM_000143.3:c.563delA
+#160:4453 NM_144997.5:c.1062+2T>G
+#158:4466 NM_144997.5:c.17_21delCTCTC
+#160:4456 FLCN:p.E328*
+#157:2816 HRAS:p.G12C
+#157:4487 NM_000222.2:c.1651_1659delCCCATGTAT
+#159:4464 NM_000222.2:c.1655_1672delTGTATGAAGTACAGTGGA
+#157:4490 NM_000222.2:c.1659_1715delTGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGA
+#158:4475 NM_000222.2:c.1663_1689delGTACAGTGGAAGGTTGTTGAGGAGATA
+#158:4476 NM_000222.2:c.1668_1679delGTGGAAGGTTGT
+#159:4469 NM_000222.2:c.1670_1675delGGAAGG
+#160:4467 NM_000222.2:c.1672_1674delAAG
+#158:4480 NM_000222.2:c.1676_1684delTTGTTGAGG
+#157:4498 NM_000222.2:c.1678_1728delGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTT
+#160:4472 NM_000222.2:c.1683_1736delGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGA
+#159:4477 NM_000222.2:c.1716_1736dupCCCAACACAACTTCCTTATGA
+#159:5195 KIT:p.L576P
+#157:4504 NM_000222.2:c.1739_1740insTATGATCAA
+#157:5306 KIT:p.C809G
+#157:2830 KIT:p.N822K
+#159:4486 MEN1:p.M1V
+#158:4496 MEN1:p.E240*
+#157:4514 NM_000245.2:c.78dupT
+#159:4492 NM_000249.3:c.1039-2A>T
+#160:4490 MLH1:p.L40*
+#157:1643 MLH1:p.R487*
+#160:4493 MLH1:p.E557*
+#160:4495 MLH1:p.W597*
+#157:4524 NM_000249.3:c.1898_1989+1delAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAGG
+#158:761 MLH1:p.R659*
+#160:5240 MLH1:p.G67R
+#160:4502 NM_000249.3:c.2103+1G>C
+#158:1139 MLH1:p.R100*
+#157:4533 NM_000249.3:c.380+1G>A
+#159:4510 NM_000249.3:c.460delG
+#160:4508 NM_000249.3:c.588+2T>G
+#159:4513 MLH1:p.R226L
+#160:4511 NM_000249.3:c.747_750delAAAC
+#159:4516 NM_000249.3:c.884+4A>G
+#158:4526 NM_000251.2:c.1077_1276delATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTTCGTCGATTCCCAGATCTTAACCGACTTGCCAAGAAGTTTCAAAGACAAGCAGCAAACTTACAAGATTGTTACCGACTCTATCAGGGTATAAATCAACTACCTAATGTTATACAGGCTCTGGAAAAACATGAAG
+#160:4516 NM_000251.2:c.1222dupT
+#158:4529 NM_000251.2:c.1277-2_1278delinsCC
+#160:1548 MSH2:p.E48*
+#160:4521 MSH2:p.K537*
+#157:4550 NM_000251.2:c.1786_1788delAAT
+#157:4552 NM_000251.2:c.1935delA
+#157:2410 MSH2:p.R680*
+#158:4539 NM_000251.2:c.212-1G>A
+#158:4541 NM_000251.2:c.2211-1G>C
+#159:793 MSH2:p.Q816*
+#159:4536 NM_000251.2:c.2634+5G>T
+#159:4537 NM_000251.2:c.513delG
+#158:4547 NM_000251.2:c.613_616dupGAGA
+#157:4565 NM_000251.2:c.942+2_942+3delTA
+#157:4566 NM_000251.2:c.943-1G>A
+#158:4552 NM_000179.2:c.1162dupC
+#160:4542 MSH6:p.Q572*
+#158:4555 MSH6:p.C687*
+#157:4573 MSH6:p.Q776*
+#158:4559 NM_000179.2:c.2719_2720delGT
+#158:4561 NM_000179.2:c.3037_3041delAAGAA
+#159:3379 MSH6:p.R1035*
+#158:4565 NM_000179.2:c.3173-1G>T
+#157:4583 NM_000179.2:c.3261delC
+#157:4584 NM_000179.2:c.3312delT
+#158:4569 NM_000179.2:c.3473_3476delinsCT
+#158:4570 NM_000179.2:c.3514dupA
+#158:4572 NM_000179.2:c.3633dupT
+#159:4565 NM_000179.2:c.3880dupT
+#160:4563 NM_000179.2:c.3962_3966dupGAGAA
+#157:4592 MSH6:p.K155*
+#160:4566 NM_000179.2:c.652_653delAA
+#158:4579 NM_000179.2:c.741delA
+#160:4570 NM_001128425.1:c.1101dupC
+#160:143 MUTYH:p.R109W
+#159:4578 MUTYH:p.E206*
+#160:4577 NM_001128425.1:c.933_933+1delAG
+#157:4606 NM_002485.4:c.698_701delAACA
+#160:2417 NF1:p.R440*
+#160:4582 NF1:p.Q519*
+#158:4596 NM_001042492.2:c.1882dupT
+#159:4590 NM_001042492.2:c.2449dupA
+#157:4617 NM_001042492.2:c.3170delC
+#158:4603 NM_001042492.2:c.3457_3460delCTCA
+#160:4594 NM_001042492.2:c.3731_3749dupTTACTCTGTTTGATTCTCG
+#159:4600 NM_001042492.2:c.4084delC
+#158:4611 NM_001042492.2:c.4966_4973delACAGACTT
+#159:779 NF1:p.Q1891*
+#158:4616 NF1:p.Y1948*
+#157:4635 NM_001042492.2:c.647delT
+#159:4613 NF1:p.Q2302*
+#157:4639 NM_001042492.2:c.768dupT
+#159:4617 NM_001042492.2:c.7971-1G>T
+#160:4616 NM_024675.3:c.1056_1057delGA
+#157:4645 NM_024675.3:c.1485delA
+#159:4622 NM_024675.3:c.1880_1881delTG
+#159:4624 NM_024675.3:c.2167_2168delAT
+#157:4650 NM_024675.3:c.2325dupA
+#160:4624 NM_024675.3:c.2727_2728delTT
+#158:3153 PALB2:p.W1038*
+#157:4656 NM_024675.3:c.3295_3310delinsCGTGGT
+#160:4630 NM_024675.3:c.509_510delGA
+#160:1960 PDGFRA:p.N659K
+#158:4645 NM_000535.5:c.1239delA
+#160:4636 NM_000535.5:c.149delG
+#159:4641 PMS2:p.K614*
+#160:4640 PMS2:p.M1V
+#157:4669 PMS2:p.R802*
+#159:4646 PMS2:p.M1K
+#158:4656 PMS2:p.Q205*
+#159:3372 PMS2:p.R315*
+#157:4676 PTEN:p.Y46*
+#160:4650 PTEN:p.E99*
+#159:3493 PTEN:p.L146*
+#159:5250 PTEN:p.R173C
+#157:4685 PTEN:p.Y240*
+#157:3326 PTEN:p.W274*
+#159:4665 PTEN:p.L320*
+#157:4692 NM_058216.1:c.224dupA
+#159:4669 NM_058216.1:c.968_1026+2delTGGCAACATTGTACAAGTCACCCAGCCAGAAGGAATGCACAGTACTGTTTCAAATCAAAGT
+#160:4667 NM_000321.2:c.1215+63T>G
+#158:5281 RET:p.C609Y
+#158:1992 RET:p.C620R
+#158:2896 RET:p.C634Y
+#160:188 RET:p.V804M
+#157:4704 NM_001754.4:c.242_245dupTGCT
+#157:4706 RUNX1:p.W106*
+#157:4708 NM_001754.4:c.400_412delGCTGGCAATGATG
+#158:4694 NM_001754.4:c.548dupC
+#160:4685 NM_001754.4:c.941_942delCT
+#157:4715 SDHA:p.E491*
+#159:3350 SDHA:p.R31*
+#158:4703 NM_003000.2:c.286+1G>A
+#160:4693 NM_003000.2:c.423+1G>A
+#159:4698 NM_003001.3:c.97delA
+#157:4725 SDHD:p.D92Y
+#160:4699 SDHD:p.W105*
+#157:4729 SMAD4:p.E390*
+#160:4703 NM_005359.5:c.1290_1291insT
+#158:4717 SMAD4:p.W101*
+#158:4719 SMAD4:p.Q224*
+#158:4721 NM_005359.5:c.806_810delCTGGA
+#159:4715 NM_001128849.1:c.3638delA
+#160:4714 STK11:p.K41*
+#157:1497 STK11:p.K84*
+#159:4722 STK11:p.E130*
+#157:4749 NM_000455.4:c.516dupT
+#157:4751 NM_000455.4:c.64delA
+#158:4737 NM_000455.4:c.741_775delCATCACCACGGGTCTGTACCCCTTCGAAGGGGACA
+#158:1109 STK11:p.R304W
+#158:4742 TP53:p.E339*
+#159:4736 TP53:p.E343*
+#160:4735 TP53:p.Q38*
+#159:4740 NM_000546.5:c.184delG
+#157:4767 NM_000546.5:c.216dupC
+#160:4741 NM_000546.5:c.254delC
+#157:4771 NM_000546.5:c.278delT
+#158:4757 NM_000546.5:c.293delC
+#158:4759 NM_000546.5:c.315delC
+#158:4761 NM_000546.5:c.357_364delCAAGTCTG
+#159:4755 TP53:p.T125=
+#158:4765 NM_000546.5:c.403delT
+#159:4759 NM_000546.5:c.423_435delCCCTGTGCAGCTG
+#160:4758 NM_000546.5:c.426delT
+#158:4772 NM_000546.5:c.450_453dupACCC
+#159:4766 NM_000546.5:c.455dupC
+#159:4768 NM_000546.5:c.466delC
+#160:4767 NM_000546.5:c.485_488delTCTA
+#157:4797 TP53:p.Q167*
+#158:4783 NM_000546.5:c.532delC
+#159:4777 NM_000546.5:c.569_574delinsTTCTT
+#157:2382 TP53:p.R196*
+#160:3150 TP53:p.E204*
+#158:2023 TP53:p.R213Q
+#158:4794 TP53:p.E221*
+#158:4796 NM_000546.5:c.686_687delGT
+#158:4798 NM_000546.5:c.721delT
+#159:4792 TP53:p.G244C
+#158:2240 TP53:p.M246I
+#160:4794 NM_000546.5:c.762_769dupCATCACAC
+#157:4824 NM_000546.5:c.775_782+9delGACTCCAGGTCAGGAGC
+#157:4826 TP53:p.E271*
+#157:4828 NM_000546.5:c.834_841delTGGGAGAG
+#160:4803 TP53:p.E287*
+#157:4833 TP53:p.K291*
+#159:4810 NM_000546.5:c.880delG
+#157:4837 NM_000546.5:c.90_91insCCTT
+#157:4839 NM_000546.5:c.920-2A>G
+#159:4817 NM_000546.5:c.97-1_112delGTCCCCCTTGCCGTCCC
+#160:4816 TSC1:p.Q4*
+#160:5301 VHL:p.E70K
+#157:4846 NM_000551.3:c.463+4C>G
+#159:4823 NM_024426.3:c.1109delGinsCC
+#159:4825 NM_000038.4:c.1369dupT
+#158:4835 APC:p.K975*
+#157:4853 BRCA2:p.S1013*
+#157:4854 NM_000059.3:c.9171_9172delinsTAGC
+#158:4839 MLH1:p.S44F
+#157:4857 MUTYH:p.R245H
+#159:4834 SMAD4:p.Q256*
+#160:4832 TP53:p.K292*
+#159:3716 NM_000038.4:c.1203delG
+#160:3715 NM_000038.4:c.1307delA
+#158:3728 NM_000038.4:c.1380delA
+#159:3722 APC:p.E477*
+#160:3721 NM_000038.4:c.1537_1538delinsTG
+#159:2433 APC:p.Q541*
+#160:2447 APC:p.R554*
+#158:3739 NM_000038.4:c.1759delA
+#157:3758 APC:p.S596*
+#158:3744 APC:p.G635*
+#157:3762 APC:p.L726*
+#159:3740 APC:p.Q767*
+#160:440 APC:p.R805*
+#157:3769 NM_000038.4:c.2496delC
+#158:3755 NM_000038.4:c.2529delTinsATAGG
+#159:3749 APC:p.E855*
+#157:3776 NM_000038.4:c.271dupA
+#159:3754 APC:p.E941*
+#159:3756 NM_000038.4:c.2894delA
+#158:3767 APC:p.Q1045*
+#159:3761 APC:p.Q1095*
+#159:1476 APC:p.R1114*
+#159:3766 APC:p.Y1147*
+#158:3776 NM_000038.4:c.3532_3535delGATT
+#157:3794 NM_000038.4:c.3631_3632delAT
+#159:3771 NM_000038.4:c.3704_3720delCTGCACAGAGTAGAAGT
+#158:3781 NM_000038.4:c.3859delA
+#159:3775 APC:p.Q1294*
+#159:3777 NM_000038.4:c.3893delC
+#159:3779 NM_000038.4:c.3920_3924delTAAAA
+#157:3806 APC:p.K1310*
+#158:1484 APC:p.Q1338*
+#159:3786 NM_000038.4:c.4057_4061delGAATT
+#160:3785 NM_000038.4:c.4101_4102delGA
+#158:3799 APC:p.Y1376*
+#159:1554 APC:p.S1392*
+#159:3795 NM_000038.4:c.4209_4218delCTCCGTTCAG
+#158:3805 NM_000038.4:c.4240delG
+#158:3807 NM_000038.4:c.4283delG
+#159:3801 NM_000038.4:c.4319delC
+#157:3828 APC:p.E1464*
+#160:3802 NM_000038.4:c.4443_4455delTCTTCCAGATGCT
+#160:3804 NM_000038.4:c.4479_4480delinsC
+#160:3806 NM_000038.4:c.4592delA
+#159:3811 NM_000038.4:c.466delG
+#158:3821 NM_000038.4:c.4883delA
+#159:3814 NM_000038.4:c.543_546delAACA
+#158:626 APC:p.R213*
+#157:3150 APC:p.R232*
+#159:3822 NM_000038.4:c.853delG
+#159:2431 APC:p.R332*
+#160:3823 ATM:p.M1V
+#158:3836 ATM:p.Q852*
+#159:3829 ATM:p.Q1171*
+#159:3830 NM_000051.3:c.4373delG
+#158:3840 NM_000051.3:c.5718_5719delAA
+#159:15 ATM:p.E1978*
+#159:3835 NM_000051.3:c.7386_7387insA
+#157:3861 NM_000051.3:c.7875_7876delinsGC
+#158:3846 ATM:p.K2700*
+#159:3839 NM_004655.3:c.1987dupT
+#160:3837 NM_004329.2:c.1426_1427dupGT
+#157:3867 NM_004329.2:c.726delA
+#158:3852 NM_007294.3:c.101delC
+#159:3846 BRCA1:p.W353*
+#157:3872 NM_007294.3:c.1082_1092delCAGAGAATCCT
+#157:3873 NM_007294.3:c.1101_1102insC
+#159:3850 NM_007294.3:c.112_113delAA
+#160:3848 NM_007294.3:c.1165delA
+#157:3877 BRCA1:p.S398*
+#159:3854 NM_007294.3:c.1240_1246delGACGTTC
+#157:3880 BRCA1:p.Y422*
+#158:3865 NM_007294.3:c.1299delC
+#160:3855 NM_007294.3:c.1323_1324delAT
+#157:3884 NM_007294.3:c.1340_1341insG
+#157:3885 NM_007294.3:c.134+2T>G
+#158:3870 BRCA1:p.S451*
+#159:3863 NM_007294.3:c.1386delG
+#159:3864 NM_007294.3:c.1390delA
+#157:3890 NM_007294.3:c.1421delT
+#159:3867 NM_007294.3:c.1440_1441insA
+#160:3865 BRCA1:p.G484*
+#158:3878 NM_007294.3:c.1501_1504delAAAT
+#160:3868 NM_007294.3:c.1508delA
+#160:3869 NM_007294.3:c.1523delC
+#157:3898 NM_007294.3:c.1556delA
+#158:3883 NM_007294.3:c.1608_1611delTAAC
+#159:2492 BRCA1:p.Q544*
+#158:3886 NM_007294.3:c.1674delA
+#159:3879 NM_007294.3:c.1728dupA
+#160:3877 NM_007294.3:c.1765delA
+#159:3882 BRCA1:p.Q60*
+#157:3908 NM_007294.3:c.1812delA
+#160:3882 NM_007294.3:c.1823delA
+#159:3887 BRCA1:p.E624*
+#160:3885 NM_007294.3:c.1898delC
+#157:2950 BRCA1:p.C64Y
+#160:3888 NM_007294.3:c.1953_1956delGAAA
+#160:3889 NM_007294.3:c.1960_1961delAA
+#157:3918 NM_007294.3:c.1996delC
+#158:3461 BRCA1:p.E673*
+#158:3905 BRCA1:p.Q687*
+#158:3906 NM_007294.3:c.2077_2078insTA
+#160:240 BRCA1:p.R71G
+#160:3897 NM_007294.3:c.212+2T>C
+#157:3926 NM_007294.3:c.213-12A>G
+#158:3911 NM_007294.3:c.2142delT
+#157:3929 NM_007294.3:c.2188_2201delGAAAAAGAAGAGAA
+#159:3906 NM_007294.3:c.2197_2201delGAGAA
+#159:3907 NM_007294.3:c.2206delG
+#160:3905 NM_007294.3:c.2214delT
+#157:3934 NM_007294.3:c.2241delC
+#158:3919 BRCA1:p.E755*
+#160:3909 BRCA1:p.E765*
+#158:3922 BRCA1:p.S770L
+#159:3915 BRCA1:p.Y777*
+#160:3913 NM_007294.3:c.2359dupG
+#157:3942 NM_007294.3:c.2390_2391delAA
+#158:3927 NM_007294.3:c.2405_2406delTG
+#160:3917 BRCA1:p.Q81*
+#157:3946 NM_007294.3:c.2450delG
+#157:3947 NM_007294.3:c.2476delA
+#157:3948 NM_007294.3:c.2488_2497dupAAGTATCCAT
+#158:3933 BRCA1:p.E849*
+#160:3923 NM_007294.3:c.2586_2593delGGTTTCAA
+#158:3936 NM_007294.3:c.2612_2613insT
+#159:3929 NM_007294.3:c.2637delA
+#160:3927 NM_007294.3:c.2670delG
+#160:3928 NM_007294.3:c.2685_2686delAA
+#160:3929 NM_007294.3:c.2709delT
+#158:3942 NM_007294.3:c.2726_2730delATCAA
+#159:3935 BRCA1:p.Q910*
+#160:3934 NM_007294.3:c.2744_2745delCT
+#157:3963 NM_007294.3:c.2764_2767delACAG
+#157:3964 NM_007294.3:c.2799delT
+#158:3949 NM_007294.3:c.283_286delCTTG
+#160:3939 NM_007294.3:c.2840_2841delAA
+#158:3952 BRCA1:p.Q957*
+#158:3953 NM_007294.3:c.290_291delCA
+#159:3946 BRCA1:p.L974*
+#157:3972 NM_007294.3:c.2940delA
+#158:3957 BRCA1:p.K995*
+#158:3958 NM_007294.3:c.3005delA
+#159:3951 BRCA1:p.S1007*
+#159:3952 NM_007294.3:c.302-2A>T
+#160:3950 NM_007294.3:c.3029_3030delCT
+#158:3963 NM_007294.3:c.3053_3054insTGAGA
+#159:3956 NM_007294.3:c.3108delT
+#157:3982 NM_007294.3:c.317delA
+#157:3983 NM_007294.3:c.3205delC
+#157:3984 NM_007294.3:c.3226delA
+#158:3969 NM_007294.3:c.3254_3255dupGA
+#158:3971 BRCA1:p.Q1090*
+#159:3964 NM_007294.3:c.3292_3293delCT
+#160:3962 BRCA1:p.C1103*
+#158:3975 NM_007294.3:c.3325_3329delAAAAA
+#158:3976 NM_007294.3:c.3331_3334delCAAG
+#157:3994 BRCA1:p.E1114*
+#158:3979 NM_007294.3:c.3358_3359delGT
+#158:3980 NM_007294.3:c.3375_3376delTC
+#160:3970 BRCA1:p.L1133*
+#158:3983 NM_007294.3:c.3413delG
+#160:3973 NM_007294.3:c.3436_3439delTGTT
+#160:3974 NM_007294.3:c.3481_3491delGAAGATACTAG
+#158:3987 BRCA1:p.Q1182*
+#158:3988 NM_007294.3:c.3580delA
+#157:2414 BRCA1:p.R1203*
+#157:4007 NM_007294.3:c.3629_3630delAG
+#158:3992 NM_007294.3:c.3648dupA
+#160:3982 NM_007294.3:c.3668_3671dupTTCC
+#158:3995 NM_007294.3:c.3699delA
+#159:3988 NM_007294.3:c.3710delT
+#160:3986 NM_007294.3:c.3736delA
+#157:4015 NM_007294.3:c.3759_3760delTA
+#157:4016 NM_007294.3:c.3762_3763delGA
+#159:3993 NM_007294.3:c.3778_3779insA
+#160:3991 NM_007294.3:c.3794delA
+#157:4020 NM_007294.3:c.3841_3842delCA
+#158:4005 NM_007294.3:c.3862delG
+#160:3995 BRCA1:p.S1298*
+#159:4000 BRCA1:p.Y130*
+#160:3998 NM_007294.3:c.3932delA
+#159:4003 BRCA1:p.Q1323*
+#160:4001 BRCA1:p.K1338*
+#157:4030 NM_007294.3:c.4041_4042delAG
+#160:4004 BRCA1:p.Q1359*
+#157:4033 NM_007294.3:c.4097-1G>A
+#157:4034 NM_007294.3:c.4113delG
+#158:4019 NM_007294.3:c.4122_4123delTG
+#157:815 BRCA1:p.S1383*
+#157:4038 NM_007294.3:c.4165_4166delAG
+#158:4023 NM_007294.3:c.4185+1G>T
+#160:4013 BRCA1:p.Q1396*
+#157:4042 BRCA1:p.E141*
+#158:4027 NM_007294.3:c.4251_4252delGT
+#157:4045 BRCA1:p.A1438=
+#160:4019 NM_007294.3:c.4348delT
+#160:4020 NM_007294.3:c.4358-31_4358-27delAAGTA
+#158:4033 NM_007294.3:c.4379delG
+#160:4023 NM_007294.3:c.4391delC
+#159:4028 NM_007294.3:c.442-2A>C
+#160:1839 BRCA1:p.R1495K
+#159:4031 BRCA1:p.S1496*
+#158:4041 NM_007294.3:c.4533_4534delCA
+#157:4059 NM_007294.3:c.4574_4575delAA
+#160:4033 NM_007294.3:c.4611_4612insG
+#159:4038 NM_007294.3:c.4625_4626delCT
+#158:4048 NM_007294.3:c.4675+1G>A
+#160:4038 BRCA1:p.E1559Q
+#158:4051 BRCA1:p.Y1563*
+#158:4052 NM_007294.3:c.4749_4750delAG
+#157:2396 BRCA1:p.Q1604*
+#158:4055 NM_007294.3:c.4936delG
+#158:4056 NM_007294.3:c.4945delA
+#160:4046 BRCA1:p.E1661*
+#160:4047 NM_007294.3:c.4986+4A>T
+#158:4060 BRCA1:p.K1667*
+#158:4061 NM_007294.3:c.5035_5039delCTAAT
+#160:4051 BRCA1:p.Q169*
+#157:4080 NM_007294.3:c.5074+3A>G
+#160:4054 NM_007294.3:c.5075-1G>A
+#157:4083 BRCA1:p.E1694*
+#157:1840 BRCA1:p.R1699Q
+#159:927 BRCA1:p.A1708E
+#160:4060 NM_007294.3:c.5137delG
+#159:4065 NM_007294.3:c.514delC
+#159:4066 NM_007294.3:c.5152+1G>T
+#159:4067 NM_007294.3:c.5153-2delA
+#157:4093 NM_007294.3:c.516delA
+#159:4070 NM_007294.3:c.5177_5180delGAAA
+#160:4068 NM_007294.3:c.5193+3_5193+15delAAGTACTTGATGT
+#160:4069 NM_007294.3:c.5194_5277delCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAG
+#158:4082 NM_007294.3:c.520delC
+#157:4100 NM_007294.3:c.5241delA
+#159:937 BRCA1:p.R1753T
+#158:4087 NM_007294.3:c.5276delA
+#159:4080 NM_007294.3:c.5277+1G>A
+#160:4078 NM_007294.3:c.5278-2A>G
+#157:4107 NM_007294.3:c.5304delC
+#157:4108 NM_007294.3:c.5320_5321delAA
+#158:4093 NM_007294.3:c.5333-1G>C
+#160:4083 BRCA1:p.W1782*
+#159:4088 NM_007294.3:c.5386delT
+#160:4086 NM_007294.3:c.5407-1G>A
+#160:4087 NM_007294.3:c.5417delC
+#159:4092 BRCA1:p.E1817*
+#159:4093 NM_007294.3:c.5468-1G>A
+#159:4094 NM_007294.3:c.547+2T>A
+#159:4095 NM_007294.3:c.5498_5511delTGACCCGAGAGTGG
+#158:4105 BRCA1:p.W1837*
+#157:4123 BRCA1:p.Q1846*
+#160:4097 NM_007294.3:c.65delT
+#158:4110 NM_007294.3:c.671-1G>T
+#158:4111 NM_007294.3:c.68_69delAG
+#159:4104 NM_007294.3:c.70_80delTGTCCCATCTG
+#160:4102 NM_007294.3:c.775delG
+#157:4131 NM_007294.3:c.798_799delTT
+#158:4116 NM_007294.3:c.81-1G>A
+#160:4106 NM_007294.3:c.815_824dupAGCCATGTGG
+#157:4135 NM_007294.3:c.843_846delCTCA
+#159:4112 BRCA1:p.E29*
+#159:4113 NM_007294.3:c.911delT
+#159:4114 NM_007294.3:c.930delG
+#157:4140 NM_007294.3:c.954_955insGT
+#158:4125 NM_007294.3:c.981_982delAT
+#159:4118 NM_000059.3:c.1054dupT
+#157:4144 NM_000059.3:c.1138delA
+#158:4129 NM_000059.3:c.1189_1190insTTAG
+#159:4122 NM_000059.3:c.1231delA
+#160:4120 NM_000059.3:c.1265delA
+#160:4121 NM_000059.3:c.1296_1297delGA
+#157:4150 BRCA2:p.K467*
+#160:3447 BRCA2:p.E49*
+#157:4153 NM_000059.3:c.151delG
+#158:4138 NM_000059.3:c.1597delA
+#158:4139 NM_000059.3:c.1654delT
+#157:4157 NM_000059.3:c.1705delC
+#158:4142 NM_000059.3:c.1755_1759delGAAAA
+#159:4135 NM_000059.3:c.1796_1800delCTTAT
+#159:4137 BRCA2:p.K607*
+#157:4163 NM_000059.3:c.1853_1854insA
+#158:4148 NM_000059.3:c.1909+1G>A
+#157:4166 BRCA2:p.M1V
+#158:4151 NM_000059.3:c.204delA
+#160:4141 NM_000059.3:c.2091delA
+#157:4170 BRCA2:p.Q742*
+#158:4155 NM_000059.3:c.2330dupA
+#159:4149 BRCA2:p.Y803*
+#157:4175 NM_000059.3:c.2446delG
+#158:4160 NM_000059.3:c.2514delA
+#157:4178 NM_000059.3:c.2564_2565delCA
+#159:4155 NM_000059.3:c.2603delC
+#160:4153 NM_000059.3:c.2636_2637delCT
+#160:4154 NM_000059.3:c.2684delC
+#157:4183 BRCA2:p.Q92*
+#157:4184 NM_000059.3:c.2805_2808delTAAA
+#158:4169 BRCA2:p.Q940*
+#159:4162 NM_000059.3:c.2836_2837delGA
+#160:4160 NM_000059.3:c.2930_2940delTGAATATAGAT
+#159:4165 BRCA2:p.K100*
+#160:4163 BRCA2:p.K1026*
+#158:2483 BRCA2:p.L105*
+#158:4178 BRCA2:p.Q1056*
+#159:2482 BRCA2:p.Q1063*
+#158:4181 NM_000059.3:c.3226_3230delGTAGT
+#160:4171 BRCA2:p.Q1089*
+#157:4200 NM_000059.3:c.3295delT
+#157:4202 BRCA2:p.Y1135*
+#159:4179 BRCA2:p.E1157*
+#160:4177 NM_000059.3:c.3554_3555delCA
+#157:4206 NM_000059.3:c.3680_3681delTG
+#157:4207 NM_000059.3:c.3696delA
+#159:4184 NM_000059.3:c.3717delA
+#157:4210 BRCA2:p.S1262*
+#159:4187 NM_000059.3:c.3837delT
+#159:4188 NM_000059.3:c.3860delA
+#157:4214 NM_000059.3:c.3911delC
+#159:4191 NM_000059.3:c.3930_3939delTGAAAATTAC
+#160:4190 NM_000059.3:c.3950_3953delCTGA
+#158:4203 NM_000059.3:c.3975_3978dupTGCT
+#159:4196 NM_000059.3:c.4007_4008insCATC
+#159:4197 NM_000059.3:c.4043_4044delGT
+#159:4198 NM_000059.3:c.4092_4093delAT
+#158:4208 BRCA2:p.Q1371*
+#159:4201 NM_000059.3:c.4137_4141delGATTA
+#160:4199 NM_000059.3:c.4188delA
+#158:4212 NM_000059.3:c.4258delG
+#159:4205 NM_000059.3:c.4314delC
+#160:4203 NM_000059.3:c.4405_4409delGACAT
+#157:4232 NM_000059.3:c.4423delA
+#157:4233 NM_000059.3:c.4472_4475delTGAA
+#159:4210 NM_000059.3:c.4551_4554delAGAA
+#160:4208 NM_000059.3:c.4593dupA
+#158:4221 NM_000059.3:c.4638delT
+#160:4211 NM_000059.3:c.4691dupC
+#157:4240 NM_000059.3:c.4731_4736delinsG
+#157:4241 NM_000059.3:c.475+2T>C
+#159:4218 NM_000059.3:c.4797delT
+#160:4216 NM_000059.3:c.4845_4846delCT
+#158:4229 NM_000059.3:c.488dupG
+#160:4219 NM_000059.3:c.4936_4939delGAAA
+#158:4232 NM_000059.3:c.4980_4981insG
+#158:4233 NM_000059.3:c.5065_5066delinsAAA
+#159:4226 BRCA2:p.E1703*
+#159:4227 NM_000059.3:c.5141_5144delATTT
+#160:4225 BRCA2:p.S1720*
+#157:4254 NM_000059.3:c.517_518delGG
+#159:4231 NM_000059.3:c.5213_5216delCTTA
+#159:4232 NM_000059.3:c.5217_5224delTTTAAGTA
+#160:4230 NM_000059.3:c.5238dupT
+#159:4235 NM_000059.3:c.5266_5269delGTAT
+#159:4237 BRCA2:p.Y1762*
+#160:4235 NM_000059.3:c.5344_5345delCA
+#157:4264 NM_000059.3:c.5351dupA
+#158:4249 NM_000059.3:c.541delT
+#160:4239 NM_000059.3:c.5465dupA
+#158:4252 NM_000059.3:c.5542delA
+#157:4270 NM_000059.3:c.5577_5580delTAAA
+#157:4271 NM_000059.3:c.5609_5610delinsAG
+#158:4256 NM_000059.3:c.5631_5634delCAAC
+#160:4247 BRCA2:p.Y1894*
+#158:4260 NM_000059.3:c.5722_5723delCT
+#158:4261 NM_000059.3:c.5771_5774delTTCA
+#157:4279 BRCA2:p.Q1931*
+#158:4264 BRCA2:p.W194*
+#159:4257 NM_000059.3:c.5828delC
+#160:4255 NM_000059.3:c.5857delG
+#158:4268 NM_000059.3:c.5891delA
+#160:4258 NM_000059.3:c.5946_5949delTGGA
+#158:4271 NM_000059.3:c.5960delA
+#159:4264 NM_000059.3:c.6012_6016delAGATA
+#157:4290 BRCA2:p.K2013*
+#158:4275 NM_000059.3:c.6068_6072delACCAG
+#159:4268 NM_000059.3:c.6079dupA
+#159:4269 NM_000059.3:c.610delC
+#157:4295 BRCA2:p.G2057*
+#157:4296 NM_000059.3:c.6202dupA
+#158:4281 NM_000059.3:c.6220_6222delinsAA
+#159:4274 NM_000059.3:c.6270_6271delTA
+#159:4275 NM_000059.3:c.6282_6289delTTCACCTA
+#158:5280 BRCA2:p.V211I
+#158:4286 NM_000059.3:c.6325_6326delGT
+#158:4287 NM_000059.3:c.635_636delGA
+#159:4280 BRCA2:p.K2128*
+#160:4278 NM_000059.3:c.63delA
+#160:4279 NM_000059.3:c.6434delA
+#160:4280 NM_000059.3:c.6445_6446delinsTTAA
+#157:4309 BRCA2:p.Y2154*
+#158:4294 NM_000059.3:c.6494delT
+#159:4287 NM_000059.3:c.6534_6535insA
+#158:4297 NM_000059.3:c.658_659delGT
+#158:4298 NM_000059.3:c.6603_6604delTG
+#158:4299 NM_000059.3:c.6638delC
+#159:4292 BRCA2:p.Y2215*
+#160:4290 NM_000059.3:c.6673delA
+#157:4319 NM_000059.3:c.67+1G>A
+#157:4320 NM_000059.3:c.6743_6755delATGCCACACATTC
+#158:4305 BRCA2:p.C2256*
+#159:4298 NM_000059.3:c.6819delAinsGT
+#160:4296 NM_000059.3:c.68_69delAT
+#157:4325 NM_000059.3:c.6941delC
+#158:4310 NM_000059.3:c.6990_6994delTACCT
+#159:5265 BRCA2:p.R2336P
+#158:4313 NM_000059.3:c.7008-2A>T
+#160:4303 BRCA2:p.Q2354*
+#158:4316 BRCA2:p.S2378*
+#159:4309 NM_000059.3:c.71_96delTAGGACCAATAAGTCTTAATTGGTTT
+#159:4310 NM_000059.3:c.7227_7228insC
+#157:4336 NM_000059.3:c.729_732delTGAT
+#158:4321 NM_000059.3:c.7362_7365dupTCAT
+#159:4314 NM_000059.3:c.7414_7415delAA
+#160:4312 BRCA2:p.Q2491*
+#157:4341 NM_000059.3:c.7543delA
+#160:4315 NM_000059.3:c.755delA
+#160:4316 NM_000059.3:c.7575delA
+#160:4317 NM_000059.3:c.7617+1G>A
+#157:4346 BRCA2:p.C2549*
+#157:4347 NM_000059.3:c.767_768delCA
+#158:4332 NM_000059.3:c.771_775delTCAAA
+#158:4334 BRCA2:p.Q2580*
+#160:4324 NM_000059.3:c.7762_7764delinsTT
+#160:4325 NM_000059.3:c.7805+1G>A
+#160:4326 NM_000059.3:c.7806-2A>G
+#159:4331 BRCA2:p.W2626*
+#159:4333 BRCA2:p.C2636*
+#159:4334 NM_000059.3:c.793+1G>C
+#159:2575 BRCA2:p.Q2655*
+#159:4337 NM_000059.3:c.7977-1G>C
+#157:4363 NM_000059.3:c.79dupA
+#157:4365 NM_000059.3:c.8029delG
+#159:4342 NM_000059.3:c.8067delT
+#157:4368 NM_000059.3:c.8087delT
+#160:4342 BRCA2:p.Q2714*
+#160:4344 BRCA2:p.L2740*
+#160:4345 NM_000059.3:c.8297delC
+#158:4358 NM_000059.3:c.8340_8343delTAAC
+#158:4359 NM_000059.3:c.8400_8402delinsAAAA
+#158:4361 BRCA2:p.Q2829*
+#157:4379 NM_000059.3:c.8501delC
+#160:4353 NM_000059.3:c.8535_8538delAGAG
+#160:4354 NM_000059.3:c.8560delT
+#159:4359 NM_000059.3:c.8578_8579delAA
+#158:4369 NM_000059.3:c.8633-2A>G
+#159:4362 BRCA2:p.Q2894*
+#160:4360 NM_000059.3:c.8754+1G>A
+#159:4365 BRCA2:p.E2924*
+#157:4391 BRCA2:p.Q2957*
+#158:4376 NM_000059.3:c.8912delA
+#160:4366 NM_000059.3:c.8953+1G>T
+#160:4367 NM_000059.3:c.8954-5A>G
+#158:4380 NM_000059.3:c.8980_8983delTCAG
+#160:4370 NM_000059.3:c.9016_9017delTA
+#158:4383 BRCA2:p.S3014*
+#158:4384 NM_000059.3:c.9069_9076delTAACATAC
+#159:4377 NM_000059.3:c.9099_9100delTC
+#157:4403 BRCA2:p.P3039=
+#159:4380 NM_000059.3:c.9157delG
+#158:4390 BRCA2:p.C3069*
+#159:4383 BRCA2:p.G3086*
+#157:4409 BRCA2:p.Y3092*
+#157:4411 NM_000059.3:c.930_931delAT
+#159:4388 NM_000059.3:c.9360delT
+#159:4390 BRCA2:p.R3128*
+#159:4391 NM_000059.3:c.9408delT
+#160:4389 NM_000059.3:c.9455_9456delAG
+#159:4394 BRCA2:p.E3167=
+#159:4395 NM_000059.3:c.956dupA
+#157:4421 NM_000059.3:c.9649-2A>G
+#158:4406 BRCA2:p.Q3227*
+#159:4399 NM_000059.3:c.9868delG
+#158:4409 NM_000059.3:c.993_994delAA
+#159:4402 BRIP1:p.E45*
+#157:4428 NM_032043.2:c.2038_2039dupTT
+#159:4405 NM_032043.2:c.2519dupG
+#157:4431 CBL:p.R246*
+#157:4433 NM_004360.3:c.1212delC
+#158:4418 NM_004360.3:c.2100delT
+#157:4436 NM_004360.3:c.2398delC
+#160:4410 NM_004360.3:c.382delC
+#160:52 CDKN2A:p.Q50*
+#158:1362 CDKN2A:p.R58*
+#160:4416 NM_000077.4:c.227_228insG
+#160:4418 CDKN2A:p.E88*
+#158:4431 NM_000077.4:c.346delG
+#159:3304 CDKN2A:p.W15*
+#158:4435 NM_007194.3:c.1263delT
+#159:4428 NM_007194.3:c.277delT
+#160:4426 NM_007194.3:c.591delA
+#157:4455 NM_005228.3:c.1923_1931delTAAGATCCC
+#157:4457 NM_005228.3:c.2235_2248delinsAGAAC
+#159:4434 NM_005228.3:c.2236_2250delGAATTAAGAGAAGCA
+#160:4432 NM_005228.3:c.2237_2251delAATTAAGAGAAGCAA
+#157:4461 NM_005228.3:c.2239_2256delTTAAGAGAAGCAACATCT
+#158:4447 NM_005228.3:c.2300_2308dupCCAGCGTGG
+#158:4449 NM_005228.3:c.2309_2310insGTT
+#159:4442 NM_005228.3:c.2317_2319dupCAC
+#159:2710 EGFR:p.L858R
+#158:4455 NM_001987.4:c.1186dupA
+#160:4446 EZH2:p.K496*
+#158:4460 EZH2:p.R63*
+#159:4454 NM_000143.3:c.1082delA
+#157:4480 FH:p.R233H
+#157:4481 NM_144997.5:c.1285dupC
+#160:4455 FLCN:p.Q167*
+#157:4484 NM_032638.4:c.437delG
+#158:4470 NM_000222.2:c.1504_1509dupGCCTAT
+#159:4463 NM_000222.2:c.1653_1661delCATGTATGA
+#160:4461 NM_000222.2:c.1655_1714delTGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAG
+#158:4474 NM_000222.2:c.1660_1707delGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTT
+#159:4467 NM_000222.2:c.1663_1701delGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAAT
+#160:4465 NM_000222.2:c.1669_1674delTGGAAG
+#160:4466 NM_000222.2:c.1671_1679delGAAGGTTGT
+#158:4479 NM_000222.2:c.1673_1693delAGGTTGTTGAGGAGATAAATG
+#159:4472 NM_000222.2:c.1676_1716delinsGA
+#159:4474 NM_000222.2:c.1679_1681delTTG
+#157:4500 NM_000222.2:c.1689_1733delAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTA
+#160:4474 NM_000222.2:c.1717_1740dupCCAACACAACTTCCTTATGATCAC
+#158:4487 NM_000222.2:c.1735_1737delGAT
+#157:5305 KIT:p.K642E
+#160:5264 KIT:p.D816H
+#157:4509 MEN1:p.R420*
+#160:4483 NM_000244.3:c.202_206dupGCCCC
+#159:4488 NM_000245.2:c.3021_3028+4delTCCAGAAGGTAT
+#160:4487 MET:p.Q272*
+#160:4489 NM_000249.3:c.1162dupT
+#157:4518 NM_000249.3:c.1325_1346delinsATTTT
+#160:4492 MLH1:p.E512*
+#157:4521 NM_000249.3:c.1731+1G>A
+#158:4507 NM_000249.3:c.1837dupG
+#158:4508 NM_000249.3:c.193_200delinsTCA
+#159:4502 MLH1:p.E663D
+#159:4504 MLH1:p.K678*
+#157:4530 NM_000249.3:c.210delA
+#157:4532 MLH1:p.E102D
+#158:4517 NM_000249.3:c.381-2A>G
+#160:4507 NM_000249.3:c.469delT
+#157:4536 NM_000249.3:c.673dupA
+#160:4510 NM_000249.3:c.678-1G>A
+#158:4523 NM_000249.3:c.791-1G>A
+#157:4541 MLH1:p.Q328*
+#159:4518 NM_000251.2:c.1151dupT
+#158:4528 MSH2:p.Y408*
+#159:4521 NM_000251.2:c.1278_1386+1delAAAACACCAGAAATTATTGTTGGCAGTTTTTGTGACTCCTCTTACTGATCTTCGTTCTGACTTCTCCAAGTTTCAGGAAATGATAGAAACAACTTTAGATATGGATCAGG
+#158:4531 MSH2:p.S494*
+#158:4533 MSH2:p.S554T
+#160:4523 MSH2:p.Q601*
+#159:4528 MSH2:p.Q662*
+#158:4538 MSH2:p.G692V
+#157:2593 MSH2:p.R711*
+#157:670 MSH2:p.S743*
+#158:4543 NM_000251.2:c.2502_2508delTAATTTC
+#160:4533 NM_000251.2:c.388_389delCA
+#157:4562 MSH2:p.G174*
+#159:4539 NM_000251.2:c.745_746delAA
+#158:4549 NM_000251.2:c.942+2_942+4delTAA
+#160:4539 MSH2:p.C333Y
+#159:4544 NM_000179.2:c.1372dupC
+#157:4570 NM_000179.2:c.1784delT
+#159:4547 NM_000179.2:c.2150_2153delTCAG
+#159:4549 NM_000179.2:c.2504delA
+#157:4576 MSH6:p.R911*
+#160:4550 NM_000179.2:c.3056_3057delTA
+#160:3333 MSH6:p.Q1048*
+#160:4554 MSH6:p.R1068*
+#158:4567 NM_000179.2:c.3261dupC
+#159:4560 NM_000179.2:c.3312dupT
+#159:4561 NM_000179.2:c.3476dupA
+#160:4559 NM_000179.2:c.3524_3540delinsTT
+#160:4561 NM_000179.2:c.3794delG
+#160:4562 NM_000179.2:c.3934_3937dupGTTA
+#157:4591 NM_000179.2:c.3984_3987dupGTCA
+#159:4568 MSH6:p.S156*
+#158:4578 MSH6:p.K218*
+#160:4568 NM_000179.2:c.936delG
+#158:1949 MUTYH:p.G396D
+#160:4573 MUTYH:p.W156*
+#157:4603 MUTYH:p.R247*
+#158:4589 NM_001128425.1:c.934-2A>G
+#158:4590 NM_002485.4:c.808_809delGT
+#159:4584 NM_001042492.2:c.1370_1371delAC
+#159:4586 NF1:p.Q535*
+#160:4585 NM_001042492.2:c.2033delC
+#158:4599 NF1:p.W837*
+#160:4590 NF1:p.Q11*
+#160:4592 NF1:p.Q1174*
+#158:640 NF1:p.R1276*
+#158:4609 NF1:p.E1436*
+#157:4628 NF1:p.W1685*
+#160:4603 NF1:p.E1928*
+#160:584 NF1:p.R1968*
+#158:1508 NF1:p.R2258*
+#157:4638 NM_001042492.2:c.7188delA
+#160:4612 NF1:p.G26*
+#158:4626 NF1:p.Q2673*
+#157:4644 NM_024675.3:c.1059delA
+#159:4621 NM_024675.3:c.1592delT
+#157:4647 NM_024675.3:c.2052delC
+#157:4649 PALB2:p.L731*
+#159:1346 PALB2:p.G796*
+#157:4652 NM_024675.3:c.2749-1G>C
+#159:4630 NM_024675.3:c.3116delA
+#160:1346 PALB2:p.Y1183*
+#157:4658 NM_024675.3:c.827dupA
+#158:5207 PDGFRA:p.D842V
+#160:4634 NM_000535.5:c.1239dupA
+#158:4648 NM_000535.5:c.163+1G>A
+#157:4666 PMS2:p.L625*
+#157:4668 NM_000535.5:c.211_214delAATG
+#158:4653 NM_000535.5:c.24-12_107delinsAAAT
+#157:4671 NM_000535.5:c.427delA
+#160:4645 NM_000535.5:c.736_741delinsTGTGTGTGAAG
+#159:4650 PTCH1:p.G876*
+#158:4660 NM_000314.4:c.163delA
+#158:4662 NM_000314.4:c.306delA
+#159:4656 NM_000314.4:c.47dupA
+#160:4655 NM_000314.4:c.635-1G>A
+#159:4661 NM_000314.4:c.800delA
+#160:4660 NM_000314.4:c.867delA
+#157:4690 NM_000314.4:c.987_990delTAAA
+#158:4676 NM_058216.1:c.571+1delG
+#160:4666 NM_002878.3:c.363delA
+#157:4695 NM_000321.2:c.1893delA
+#160:4669 RET:p.C618Y
+#160:4671 RET:p.C620G
+#160:4673 RET:p.C634F
+#157:2898 RET:p.V804L
+#159:4680 NM_001754.4:c.245_246delinsCAC
+#159:4682 NM_001754.4:c.366_367dupGG
+#158:1998 RUNX1:p.Y140*
+#157:1095 RUNX1:p.R201*
+#158:4697 NM_001754.4:c.943_950delGCAGAACT
+#160:4688 SDHA:p.M1V
+#159:2902 SDHB:p.R46Q
+#159:4695 NM_003000.2:c.286+2T>A
+#158:4705 SDHB:p.P197R
+#158:4707 SDHD:p.Q36*
+#158:4709 NM_003002.2:c.278_280dupATT
+#159:4703 SDHD:p.C11*
+#159:4705 NM_005359.5:c.1207dupA
+#158:4715 SMAD4:p.Q442*
+#160:4706 NM_005359.5:c.38_57delATGATGCCTGTCTGAGCATT
+#160:4708 NM_005359.5:c.692dupG
+#160:4710 NM_005359.5:c.971_977delGTTCCAT
+#160:4712 NM_000455.4:c.1010_1011delTG
+#158:4726 NM_000455.4:c.130_131insT
+#157:4745 STK11:p.R86*
+#157:4747 NM_000455.4:c.446dupC
+#159:4725 NM_000455.4:c.563delG
+#160:4724 STK11:p.Q220*
+#157:4754 STK11:p.E256*
+#157:4756 NM_000546.5:c.1005delT
+#160:4731 NM_000546.5:c.1023_1024delinsGT
+#157:4761 NM_000546.5:c.102delC
+#157:4763 NM_000546.5:c.1146delA
+#158:4749 TP53:p.E62*
+#159:4743 NM_000546.5:c.227_279delCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTG
+#158:4753 NM_000546.5:c.267delC
+#160:4744 TP53:p.S94*
+#157:4774 TP53:p.Q100*
+#160:4748 NM_000546.5:c.320dupA
+#160:4750 NM_000546.5:c.359delA
+#157:4780 NM_000546.5:c.376-2A>G
+#160:4754 NM_000546.5:c.403dupT
+#158:4768 TP53:p.C141*
+#159:4762 TP53:p.Q144*
+#160:4761 NM_000546.5:c.454_466delCCGCCCGGCACCC
+#157:4791 NM_000546.5:c.459_460insT
+#157:5323 TP53:p.V157F
+#158:4779 NM_000546.5:c.486_489delinsAAAAAAAAAAAAAA
+#159:4773 NM_000546.5:c.510_511delinsTT
+#158:217 TP53:p.R181H
+#157:4802 TP53:p.Q192*
+#158:4788 NM_000546.5:c.591_592delinsTT
+#160:4779 NM_000546.5:c.618_619delinsT
+#159:4784 NM_000546.5:c.652_658delGTGCCCT
+#160:4783 NM_000546.5:c.669dupT
+#160:4785 NM_000546.5:c.686delG
+#160:4787 NM_000546.5:c.723delC
+#158:5298 TP53:p.G245S
+#157:5248 TP53:p.R248W
+#158:4806 NM_000546.5:c.763_764delAT
+#158:4808 NM_000546.5:c.795_796delinsTT
+#160:5206 TP53:p.R273H
+#158:5384 TP53:p.R282W
+#158:4815 NM_000546.5:c.862_869delAATCTCCG
+#159:4809 NM_000546.5:c.873_874delinsAT
+#158:4819 TP53:p.E294*
+#157:2390 TP53:p.R306*
+#160:4812 TP53:p.Q317*
+#157:4842 NM_000546.5:c.972_992delinsAG
+#157:4844 NM_000368.4:c.2341_2360dupCAGCTGCAGCATGACCGAGA
+#158:4829 NM_000551.3:c.343_463+2delCACCTTTGGCTCTTCAGAGATGCAGGGACACACGATGGGCTTCTGGTTAACCAAACTGAATTATTTGTGCCATCTCTCAATGTTGACGGACAGCCTATTTTTGCCAATATCACACTGCCAGGT
+#158:4830 NM_000551.3:c.464_642delTGTATACTCTGAAAGAGCGATGCCTCCAGGTTGTCCGGAGCCTAGTCAAGCCTGAGAATTACAGGAGACTGGACATCGTCAGGTCGCTCTACGAAGATCTGGAAGACCACCCAAATGTGCAGAAAGACCTGGAGCGGCTGACACAGGAGCGCATTGCACATCAACGGATGGGAGATTGA
+#160:4820 NM_024426.3:c.1147_1150dupTCTG
+#157:4850 APC:p.S457*
+#160:4824 APC:p.K980*
+#158:4837 NM_000059.3:c.4576dupA
+#158:4838 NM_000077.4:c.180_181insCTCG
+#160:4828 MLH1:p.Q146*
+#158:4841 NM_024675.3:c.1037_1041delAAGAA
+#160:4831 NM_000455.4:c.150delG
+#157:4860 NM_000546.5:c.93delT
+#159:1531 APC:p.R405*
+#158:3727 NM_000038.4:c.1312+1G>A
+#160:3717 NM_000038.4:c.1409-2delA
+#158:3731 APC:p.C483*
+#157:3749 NM_000038.4:c.1582_1585delGCAC
+#157:3751 NM_000038.4:c.1647dupG
+#157:576 APC:p.R564*
+#157:3756 APC:p.L592*
+#159:3734 NM_000038.4:c.1860_1867dupTACTTACC
+#160:3733 NM_000038.4:c.1916delT
+#159:3738 NM_000038.4:c.2227_2228delAT
+#157:3765 NM_000038.4:c.2321delA
+#157:440 APC:p.S811*
+#158:2432 APC:p.S837*
+#160:3744 APC:p.E847*
+#157:3774 NM_000038.4:c.2570delG
+#159:3752 NM_000038.4:c.2763_2767dupACTTA
+#157:3779 NM_000038.4:c.2824_2827delAATT
+#158:3765 APC:p.Q978*
+#160:2469 APC:p.W1049*
+#158:3770 APC:p.C110*
+#159:3764 NM_000038.4:c.3344delT
+#160:3763 NM_000038.4:c.3447delA
+#157:3793 APC:p.L1181*
+#159:3770 NM_000038.4:c.3631delA
+#157:3796 NM_000038.4:c.3733_3734delAA
+#157:3798 APC:p.G1288*
+#157:3800 NM_000038.4:c.3883delG
+#157:3802 NM_000038.4:c.3902_3906delinsTCTC
+#160:2722 APC:p.I1307K
+#159:3782 NM_000038.4:c.3944_3964delCAGCTGAAGATCCTGTGAGCG
+#158:3793 NM_000038.4:c.4044_4060delinsCTA
+#157:3811 NM_000038.4:c.4060_4076delTTTTCTTCAGGAGCGAA
+#158:3797 NM_000038.4:c.4107dupC
+#160:3788 NM_000038.4:c.4133dupA
+#157:3818 APC:p.S1400*
+#157:3820 NM_000038.4:c.423-1G>A
+#160:3794 NM_000038.4:c.4241dupT
+#160:1528 APC:p.Q1429*
+#157:3826 NM_000038.4:c.4333delA
+#159:3804 NM_000038.4:c.4393_4394delAG
+#158:3814 NM_000038.4:c.4463delT
+#157:3832 NM_000038.4:c.4497delA
+#158:3818 NM_000038.4:c.4612_4613delGA
+#157:1576 APC:p.Q161*
+#160:3810 NM_000038.4:c.509_512delATAG
+#158:3823 APC:p.E190*
+#160:439 APC:p.R216*
+#159:3820 APC:p.S254*
+#158:3831 APC:p.E287*
+#159:3825 NM_000038.4:c.995delG
+#158:3835 ATM:p.K750=
+#159:3828 NM_000051.3:c.2839-1G>A
+#160:3826 NM_000051.3:c.3626_3627delTT
+#159:1562 ATM:p.R1466*
+#160:3829 ATM:p.S1924*
+#159:3834 ATM:p.E2052K
+#160:3832 NM_000051.3:c.7638_7646delTAGAATTTC
+#158:3845 NM_000051.3:c.790delT
+#160:3835 ATM:p.K2756*
+#160:3836 NM_004656.2:c.320delA
+#158:3849 NM_004329.2:c.1464_1473delCAGTGATGAA
+#159:3843 NM_007294.3:c.1016delA
+#160:3841 BRCA1:p.C348*
+#158:3855 BRCA1:p.Q356*
+#158:3856 NM_007294.3:c.1086_1087delGA
+#159:3849 BRCA1:p.E368*
+#160:3847 NM_007294.3:c.1121delC
+#157:3876 NM_007294.3:c.1166delG
+#158:3861 NM_007294.3:c.1204delG
+#160:3851 NM_007294.3:c.124delA
+#158:3864 NM_007294.3:c.1276delT
+#160:3854 NM_007294.3:c.130delT
+#157:3883 NM_007294.3:c.133_134+3delinsT
+#158:3868 NM_007294.3:c.134+1G>C
+#158:3869 NM_007294.3:c.135-1G>C
+#160:3859 NM_007294.3:c.1356delA
+#160:3860 NM_007294.3:c.1387_1390delinsGAAAG
+#160:3861 NM_007294.3:c.1396delC
+#160:3422 BRCA1:p.L474*
+#160:3864 NM_007294.3:c.1444_1447delATTA
+#158:3877 BRCA1:p.Q491*
+#160:3867 BRCA1:p.K501*
+#157:3896 NM_007294.3:c.150delA
+#158:3881 BRCA1:p.S510*
+#158:3882 NM_007294.3:c.1561_1562delinsTA
+#160:3872 BRCA1:p.Q54*
+#159:3877 NM_007294.3:c.1636_1654delATGAATATTACTAATAGTG
+#160:3875 BRCA1:p.Q563*
+#160:3876 NM_007294.3:c.1729_1730delGA
+#158:3889 BRCA1:p.S59*
+#157:3907 BRCA1:p.L598*
+#159:3884 BRCA1:p.K607*
+#158:3894 NM_007294.3:c.1826delA
+#160:3884 NM_007294.3:c.1881_1884delCAGT
+#157:3913 NM_007294.3:c.1912delG
+#160:3887 NM_007294.3:c.1929_1930delinsA
+#157:3916 NM_007294.3:c.1953dupG
+#158:3901 BRCA1:p.K654*
+#160:838 BRCA1:p.Q667*
+#157:3920 NM_007294.3:c.2019delA
+#159:3897 NM_007294.3:c.2070_2071delAA
+#159:3898 NM_007294.3:c.2079_2080delCA
+#157:3924 NM_007294.3:c.212+1G>A
+#157:3925 NM_007294.3:c.2125_2126insA
+#158:3910 NM_007294.3:c.213-1G>A
+#160:3900 BRCA1:p.E717*
+#158:3913 NM_007294.3:c.2188dupG
+#160:3903 NM_007294.3:c.2199delG
+#157:3932 BRCA1:p.Q74*
+#157:3933 NM_007294.3:c.2215_2216insCT
+#158:3918 NM_007294.3:c.224_227delAAAG
+#159:3911 NM_007294.3:c.2269delG
+#157:3937 NM_007294.3:c.2296_2297delAG
+#159:3914 NM_007294.3:c.2314delG
+#160:3912 NM_007294.3:c.2337_2338delTC
+#157:3941 NM_007294.3:c.2376delG
+#158:3926 NM_007294.3:c.2393delC
+#159:3919 NM_007294.3:c.2406_2409delGAGT
+#157:3945 NM_007294.3:c.2433delC
+#158:3930 NM_007294.3:c.2457delC
+#158:3931 NM_007294.3:c.2477_2478delCA
+#158:3932 NM_007294.3:c.2513delA
+#159:3925 NM_007294.3:c.2560_2561dupGC
+#157:3951 NM_007294.3:c.2594delA
+#159:3928 NM_007294.3:c.2612delCinsTT
+#157:3954 BRCA1:p.E881*
+#157:3955 NM_007294.3:c.2675_2678delTAAA
+#157:3956 NM_007294.3:c.2686delA
+#158:1563 BRCA1:p.E904*
+#159:3934 NM_007294.3:c.2726delA
+#157:3960 NM_007294.3:c.2739_2740delTG
+#157:3962 NM_007294.3:c.2745_2751dupTAATATC
+#158:3947 NM_007294.3:c.2766delA
+#158:718 BRCA1:p.Q934*
+#157:3966 BRCA1:p.C944*
+#158:3951 BRCA1:p.S955*
+#159:3944 NM_007294.3:c.2871_2872insA
+#159:3945 NM_007294.3:c.2910delA
+#157:3971 BRCA1:p.Q975*
+#158:3956 NM_007294.3:c.2952delT
+#159:3949 NM_007294.3:c.2989_2990dupAA
+#159:3950 NM_007294.3:c.3008_3009delTT
+#160:3948 NM_007294.3:c.302-1G>A
+#160:3949 NM_007294.3:c.302-2delA
+#158:3962 BRCA1:p.Y101*
+#159:3955 NM_007294.3:c.3084_3094delTAATAACATTA
+#157:3981 BRCA1:p.E1038*
+#158:3966 NM_007294.3:c.3181delA
+#158:3967 NM_007294.3:c.321_322delinsC
+#158:3968 NM_007294.3:c.3228_3229delAG
+#159:3961 NM_007294.3:c.3255_3261delATTAGGG
+#160:3960 BRCA1:p.Q1096*
+#160:3961 NM_007294.3:c.329_330delAG
+#157:3990 NM_007294.3:c.3318_3361delTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTA
+#159:3967 NM_007294.3:c.3326_3329delAAAA
+#160:3965 BRCA1:p.Q1111*
+#158:3978 NM_007294.3:c.3342_3345delAGAA
+#159:3971 NM_007294.3:c.3359_3360delTT
+#160:3969 BRCA1:p.S1130*
+#158:3982 BRCA1:p.E1134*
+#160:3972 NM_007294.3:c.3417delT
+#157:4001 NM_007294.3:c.3442delG
+#157:4002 NM_007294.3:c.3485delA
+#159:3979 NM_007294.3:c.3548_3549delAA
+#159:3980 NM_007294.3:c.3583delC
+#157:4006 NM_007294.3:c.3612delA
+#158:3991 NM_007294.3:c.3633delC
+#159:3984 NM_007294.3:c.3649_3650insA
+#157:4010 NM_007294.3:c.3676_3679delTTCC
+#159:3987 NM_007294.3:c.3700_3704delGTAAA
+#160:3985 NM_007294.3:c.3715_3717delinsC
+#157:4014 NM_007294.3:c.37_40delAATG
+#158:3999 NM_007294.3:c.3759dupT
+#158:4000 NM_007294.3:c.3770_3771delAG
+#160:3990 NM_007294.3:c.3779delT
+#158:4003 BRCA1:p.Q1273*
+#159:1717 BRCA1:p.Q1281*
+#159:3997 NM_007294.3:c.3867_3871delAAAAT
+#158:4007 BRCA1:p.Q1299*
+#160:3997 NM_007294.3:c.3916_3917delTT
+#158:4010 BRCA1:p.Q1313*
+#160:4000 NM_007294.3:c.3972delG
+#158:4013 BRCA1:p.E1339*
+#159:4006 BRCA1:p.E1352*
+#157:4032 NM_007294.3:c.4085delA
+#158:4017 NM_007294.3:c.4097-2A>G
+#158:4018 NM_007294.3:c.4116_4117delTG
+#160:4008 BRCA1:p.E1375*
+#157:798 BRCA1:p.Q139*
+#158:4022 NM_007294.3:c.4167_4168insAG
+#159:4015 NM_007294.3:c.4185+2_4185+22delinsA
+#157:4041 NM_007294.3:c.4195_4196delAC
+#158:2485 BRCA1:p.Q1408*
+#160:4016 BRCA1:p.Q1420*
+#157:241 BRCA1:p.R1443*
+#157:4047 NM_007294.3:c.4357+1G>A
+#158:4032 BRCA1:p.S1457*
+#157:4050 BRCA1:p.Y1463*
+#160:1143 BRCA1:p.Q1467*
+#157:4053 BRCA1:p.E1494*
+#159:2046 BRCA1:p.R1495M
+#158:731 BRCA1:p.S1503*
+#160:4030 BRCA1:p.Q1518*
+#159:4035 NM_007294.3:c.4595_4596insCT
+#160:1599 BRCA1:p.Q1538*
+#160:4035 NM_007294.3:c.4655_4658delACTT
+#159:4040 NM_007294.3:c.4675+1G>T
+#157:4066 NM_007294.3:c.4676-1G>A
+#159:4043 NM_007294.3:c.470_471delCT
+#159:4044 NM_007294.3:c.4754_4755delCA
+#157:4070 NM_007294.3:c.485_486delTG
+#159:4047 NM_007294.3:c.493delC
+#159:4048 NM_007294.3:c.494dupT
+#157:4074 NM_007294.3:c.4986+1G>A
+#157:4075 NM_007294.3:c.4986+6T>C
+#159:4052 NM_007294.3:c.5005delG
+#159:4053 NM_007294.3:c.5035delC
+#158:4063 NM_007294.3:c.5074+1G>A
+#157:1832 BRCA1:p.D1692N
+#157:4082 NM_007294.3:c.5075-1G>C
+#158:4067 NM_007294.3:c.5084_5085delTT
+#157:4085 NM_007294.3:c.5102_5103delTG
+#159:4062 NM_007294.3:c.5126delG
+#160:1841 BRCA1:p.S1715N
+#160:4062 NM_007294.3:c.5150delT
+#160:4063 NM_007294.3:c.5152+3A>C
+#157:4092 BRCA1:p.W1718*
+#158:4077 NM_007294.3:c.5172dupA
+#157:4095 BRCA1:p.K1727*
+#157:4096 NM_007294.3:c.5194-12G>A
+#159:1843 BRCA1:p.V1736A
+#158:2738 BRCA1:p.G1738R
+#158:4084 NM_007294.3:c.5243delG
+#157:4102 NM_007294.3:c.5259delA
+#159:4079 NM_007294.3:c.5277+1_5277+6delGTAAAG
+#157:4105 BRCA1:p.K1759=
+#157:4106 NM_007294.3:c.5284delA
+#158:4091 NM_007294.3:c.5310delG
+#160:934 BRCA1:p.M1775K
+#159:4085 NM_007294.3:c.5333-1G>T
+#159:4087 BRCA1:p.Q1785*
+#157:4113 BRCA1:p.S1796*
+#157:4114 NM_007294.3:c.5407-1G>C
+#157:4115 NM_007294.3:c.5419delA
+#160:4089 NM_007294.3:c.5467+1G>A
+#160:4090 NM_007294.3:c.5470_5477delATTGGGCA
+#160:4091 NM_007294.3:c.5490delA
+#160:4092 NM_007294.3:c.5503_5564delCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGAT
+#160:4094 NM_007294.3:c.5512delG
+#159:4099 BRCA1:p.C1847*
+#158:4109 BRCA1:p.K222*
+#159:4102 NM_007294.3:c.671-2A>C
+#160:4100 NM_007294.3:c.697_698delGT
+#160:4101 NM_007294.3:c.731delA
+#158:4114 BRCA1:p.Y261*
+#159:4107 BRCA1:p.S267*
+#159:4108 NM_007294.3:c.81-2A>G
+#158:4118 BRCA1:p.C274*
+#158:4119 NM_007294.3:c.844_850dupTCATTAC
+#160:4109 NM_007294.3:c.882delA
+#160:4110 NM_007294.3:c.922_923delAG
+#160:4111 NM_007294.3:c.949_953delCAACA
+#159:4116 BRCA1:p.W321*
+#159:4117 NM_007294.3:c.984_985insC
+#157:4143 BRCA2:p.L366*
+#158:4128 NM_000059.3:c.1147delA
+#160:4118 BRCA2:p.S401*
+#160:4119 NM_000059.3:c.1238delT
+#157:4148 NM_000059.3:c.1278delA
+#157:4149 NM_000059.3:c.1307delA
+#159:4126 BRCA2:p.E471*
+#158:4136 NM_000059.3:c.1483dupG
+#160:2554 BRCA2:p.E510*
+#159:4130 NM_000059.3:c.1599_1600delTG
+#160:4128 BRCA2:p.L557*
+#158:4141 NM_000059.3:c.17_18delAA
+#159:4134 NM_000059.3:c.1763_1766delATAA
+#157:4160 BRCA2:p.Y600*
+#157:4162 BRCA2:p.Q609*
+#158:4147 NM_000059.3:c.1854delCinsAA
+#159:4140 NM_000059.3:c.190delA
+#159:4142 NM_000059.3:c.2026delT
+#159:4143 NM_000059.3:c.2059_2063delGATTA
+#157:4169 NM_000059.3:c.2092delC
+#158:4154 NM_000059.3:c.2254_2257delGACT
+#160:4144 BRCA2:p.S780*
+#157:4174 BRCA2:p.L809*
+#158:4159 NM_000059.3:c.2450delA
+#157:4177 BRCA2:p.Y839*
+#158:4162 NM_000059.3:c.2586_2592delAAATCAA
+#157:4180 BRCA2:p.S871*
+#157:4181 NM_000059.3:c.263delT
+#157:4182 NM_000059.3:c.26delC
+#158:4167 NM_000059.3:c.2760delC
+#158:4168 NM_000059.3:c.2808_2811delACAA
+#158:3348 BRCA2:p.K944*
+#160:4159 NM_000059.3:c.2836delG
+#157:4188 NM_000059.3:c.2956_2957insG
+#160:4162 NM_000059.3:c.3051delC
+#158:4175 BRCA2:p.E1035*
+#158:4177 BRCA2:p.L1053*
+#160:4167 NM_000059.3:c.3167_3170delAAAA
+#159:4172 NM_000059.3:c.3189_3192delGTCA
+#159:4173 NM_000059.3:c.3228_3229delAG
+#157:4199 NM_000059.3:c.3269delT
+#159:4176 BRCA2:p.Q1107*
+#158:4186 NM_000059.3:c.3442delC
+#160:4176 NM_000059.3:c.3497delT
+#157:4205 NM_000059.3:c.3570delG
+#158:4190 NM_000059.3:c.3682_3685delAATG
+#158:4191 NM_000059.3:c.36delT
+#160:4181 NM_000059.3:c.3737delA
+#159:4186 BRCA2:p.E13*
+#160:4184 NM_000059.3:c.3847_3848delGT
+#160:4185 NM_000059.3:c.3865_3868delAAAT
+#158:4198 NM_000059.3:c.3914_3915delTT
+#158:4200 BRCA2:p.Y1313*
+#157:4218 NM_000059.3:c.3957_3960delTGAA
+#159:4195 NM_000059.3:c.3delG
+#160:4193 NM_000059.3:c.4012_4013dupGG
+#160:4194 NM_000059.3:c.4048_4051delCATA
+#157:4223 BRCA2:p.C1365*
+#160:4197 NM_000059.3:c.4130_4131insTGAGGA
+#160:4198 NM_000059.3:c.4163_4164delinsA
+#157:4227 NM_000059.3:c.4218_4221delAGAA
+#159:4204 NM_000059.3:c.4271delC
+#159:3341 BRCA2:p.S1442*
+#157:4231 NM_000059.3:c.4409_4410delTA
+#158:4216 NM_000059.3:c.4449delA
+#158:4217 NM_000059.3:c.4478_4481delAAAG
+#160:4207 NM_000059.3:c.4554delA
+#158:4220 NM_000059.3:c.462_463delAA
+#159:4213 NM_000059.3:c.4638dupT
+#158:4223 NM_000059.3:c.469_470delAA
+#158:4224 NM_000059.3:c.4740_4741dupTG
+#160:5261 BRCA2:p.V159M
+#160:4215 NM_000059.3:c.4808dupA
+#158:4228 BRCA2:p.L1620*
+#160:4218 BRCA2:p.L164*
+#157:4247 NM_000059.3:c.4947_4948delAA
+#159:4224 NM_000059.3:c.4990_4991delAT
+#159:4225 NM_000059.3:c.5070_5073delAAAA
+#160:4223 NM_000059.3:c.5116_5119delAATA
+#160:4224 NM_000059.3:c.5146_5149delTATG
+#157:4253 NM_000059.3:c.5164_5165delAG
+#160:4227 BRCA2:p.G173R
+#160:4228 NM_000059.3:c.5217_5220delTTTA
+#157:4257 BRCA2:p.Y1739*
+#158:4242 BRCA2:p.Q175*
+#160:4232 NM_000059.3:c.5270_5286delATAATGATTCAGGATAT
+#160:4234 NM_000059.3:c.5290_5291delTC
+#158:4247 BRCA2:p.Q1782*
+#158:4248 NM_000059.3:c.538_539delAT
+#158:2395 BRCA2:p.E1812*
+#158:4251 NM_000059.3:c.5471dupA
+#159:4244 NM_000059.3:c.5557delT
+#158:4254 NM_000059.3:c.5583dupA
+#160:40 BRCA2:p.K1872*
+#159:2467 BRCA2:p.S1882*
+#159:4251 NM_000059.3:c.5702_5703delAG
+#159:4252 NM_000059.3:c.5722delC
+#160:4250 BRCA2:p.Q1925*
+#158:4263 NM_000059.3:c.5796_5797delTA
+#159:4256 NM_000059.3:c.5820_5833delGAAAGTTTCTAAAA
+#157:4282 NM_000059.3:c.5835dupA
+#158:4267 BRCA2:p.E1953*
+#159:4260 NM_000059.3:c.5904_5907delAGTC
+#157:4286 NM_000059.3:c.5946delT
+#159:4263 NM_000059.3:c.5968_5969delGA
+#160:4261 NM_000059.3:c.6024dupG
+#158:4274 NM_000059.3:c.6052_6053delAG
+#160:4264 BRCA2:p.Q2024*
+#160:4265 NM_000059.3:c.6082_6086delGAAGA
+#157:4294 BRCA2:p.Q2042*
+#158:4279 NM_000059.3:c.6178delA
+#159:4272 BRCA2:p.L2069*
+#159:4273 NM_000059.3:c.6239delT
+#160:4271 NM_000059.3:c.6275_6276delTT
+#157:4300 BRCA2:p.S2103*
+#157:5304 BRCA2:p.V211L
+#159:4278 NM_000059.3:c.6335_6336delGA
+#159:4279 NM_000059.3:c.6361_6362delGA
+#160:4277 NM_000059.3:c.6390dupT
+#157:4306 NM_000059.3:c.6401_6404delATAA
+#157:4307 NM_000059.3:c.6443_6444delCT
+#157:4308 NM_000059.3:c.6446_6450delTTAAA
+#158:4293 NM_000059.3:c.6468_6469delTC
+#159:4286 NM_000059.3:c.6509_6510delAA
+#160:4284 NM_000059.3:c.6553delG
+#159:4289 NM_000059.3:c.6591_6592delTG
+#159:4290 NM_000059.3:c.662_663delTT
+#159:4291 NM_000059.3:c.6641dupC
+#157:4317 BRCA2:p.S2219*
+#157:4318 NM_000059.3:c.6676_6677delGA
+#158:4303 NM_000059.3:c.67+1G>T
+#158:4304 NM_000059.3:c.6754dupT
+#160:4294 BRCA2:p.S2267*
+#160:4295 NM_000059.3:c.682-1G>C
+#158:4308 BRCA2:p.K230*
+#158:4309 NM_000059.3:c.6944_6947delTAAA
+#159:4302 NM_000059.3:c.7003_7007delTTTCG
+#159:4304 BRCA2:p.R2336L
+#159:4305 NM_000059.3:c.700delT
+#157:4331 NM_000059.3:c.7069_7070delCT
+#159:4308 NM_000059.3:c.7142delC
+#160:4306 NM_000059.3:c.7208_7211delCCAA
+#157:4335 BRCA2:p.S2414*
+#158:4320 NM_000059.3:c.7307delA
+#160:4310 NM_000059.3:c.7378_7379insG
+#160:4311 NM_000059.3:c.7419_7420delTG
+#157:4340 NM_000059.3:c.7474_7475delGA
+#158:4325 NM_000059.3:c.7544delC
+#157:4343 NM_000059.3:c.756_757delCA
+#157:4344 NM_000059.3:c.7593delT
+#157:4345 NM_000059.3:c.7617+1G>T
+#158:4330 NM_000059.3:c.7655_7658delTTAA
+#158:4331 NM_000059.3:c.7679_7680delTT
+#160:4321 BRCA2:p.W2574*
+#160:4323 BRCA2:p.W2586*
+#157:4352 NM_000059.3:c.7762_7769delATACCCTC
+#157:4353 NM_000059.3:c.7806-1G>C
+#157:4354 NM_000059.3:c.7847delC
+#160:5412 BRCA2:p.W2626C
+#160:4330 NM_000059.3:c.7913_7917delTTCCT
+#160:4331 NM_000059.3:c.793+1G>T
+#159:4336 BRCA2:p.Y2658*
+#160:4334 NM_000059.3:c.7977-1G>T
+#159:4339 NM_000059.3:c.8012_8034delCTATAAAAAAGATAATGGAAAGG
+#159:4341 BRCA2:p.E2677*
+#157:4367 BRCA2:p.C2689*
+#157:2463 BRCA2:p.L2696*
+#159:5421 BRCA2:p.D2723H
+#157:4372 NM_000059.3:c.8234_8237delTGAC
+#159:4349 BRCA2:p.L2776*
+#159:4350 NM_000059.3:c.8343delC
+#157:4376 BRCA2:p.G2813*
+#159:4353 NM_000059.3:c.8487+1G>A
+#159:4355 BRCA2:p.S2835*
+#157:4381 NM_000059.3:c.8537_8538delAG
+#158:4366 BRCA2:p.Q2858*
+#160:4356 NM_000059.3:c.8585dupT
+#159:4361 NM_000059.3:c.8648delC
+#160:4359 NM_000059.3:c.86_87delTT
+#159:4364 BRCA2:p.E2918=
+#157:4390 BRCA2:p.Q2925*
+#159:4367 BRCA2:p.Q2960*
+#159:4368 NM_000059.3:c.891_899delinsGATACTTCAG
+#157:4394 NM_000059.3:c.8953+2T>G
+#157:4395 NM_000059.3:c.8961_8964delGAGT
+#159:4372 NM_000059.3:c.8997_8998delGT
+#158:4382 BRCA2:p.Y3006*
+#159:4375 NM_000059.3:c.9054_9055delTA
+#160:805 BRCA2:p.Q3026*
+#157:4402 BRCA2:p.Q3034*
+#158:4387 NM_000059.3:c.9118-2A>G
+#160:4377 NM_000059.3:c.9177delA
+#159:4382 NM_000059.3:c.9252_9255delinsTT
+#160:4380 NM_000059.3:c.9257-1G>A
+#159:4385 BRCA2:p.E3096*
+#158:4395 NM_000059.3:c.9310_9311delAA
+#157:4413 BRCA2:p.Q3126*
+#160:4387 NM_000059.3:c.9383dupG
+#160:4388 NM_000059.3:c.9429_9430delTT
+#157:4417 NM_000059.3:c.9466delC
+#160:4391 NM_000059.3:c.9502-2A>C
+#160:4392 NM_000059.3:c.9580_9581delCC
+#158:4405 NM_000059.3:c.9666delT
+#160:4395 NM_000059.3:c.968dupT
+#157:4424 BRCA2:p.Q3295*
+#159:4401 NM_000059.3:c.994_995insG
+#157:4427 BRIP1:p.E458*
+#158:4412 NM_032043.2:c.2108delAinsTCC
+#160:4402 NM_032043.2:c.394dupA
+#159:4407 NM_005188.3:c.896delG
+#158:4417 NM_004360.3:c.1565+1G>A
+#157:4435 CDH1:p.R74*
+#158:4420 NM_004360.3:c.2403_2412delTGCCAATCCC
+#158:4422 CDH1:p.G212*
+#159:4416 NM_000077.4:c.151-1G>A
+#159:4418 NM_000077.4:c.219delC
+#160:459 CDKN2A:p.R80*
+#158:4430 NM_000077.4:c.27_31delGGAGC
+#158:1859 CDKN2A:p.V126D
+#157:4450 NM_000077.4:c.52_83delACGGCCGCGGCCCGGGGTCGGGTAGAGGAGGT
+#158:957 CHEK2:p.S428F
+#160:4425 NM_007194.3:c.31dupC
+#157:4454 NM_177438.2:c.714_717delTGAC
+#159:2774 EGFR:p.E709G
+#158:4441 NM_005228.3:c.2235_2249delGGAATTAAGAGAAGC
+#157:4459 NM_005228.3:c.2236_2250delinsAATCCG
+#158:4444 NM_005228.3:c.2237_2255delinsT
+#159:4437 NM_005228.3:c.2240_2254delTAAGAGAAGCAACAT
+#160:4436 NM_005228.3:c.2303_2311dupGCGTGGACA
+#159:4441 NM_005228.3:c.2310_2311insGCGTGGAGA
+#159:2709 EGFR:p.T790M
+#160:1875 EGFR:p.L861Q
+#160:4444 NM_001987.4:c.934delC
+#158:4458 NM_004456.4:c.1546+1_1546+2delGT
+#160:4449 NM_004456.4:c.1973delG
+#157:4479 FH:p.S366N
+#158:4464 NM_000143.3:c.780_781delAA
+#158:3351 FLCN:p.R477*
+#157:4483 NM_144997.5:c.59delT
+#159:4460 NM_032638.4:c.599delG
+#159:4462 NM_000222.2:c.1648_1674delAAACCCATGTATGAAGTACAGTGGAAG
+#157:4488 NM_000222.2:c.1653_1670delCATGTATGAAGTACAGTG
+#158:4473 NM_000222.2:c.1656_1712delGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACAT
+#160:4463 NM_000222.2:c.1662_1685delAGTACAGTGGAAGGTTGTTGAGGA
+#160:4464 NM_000222.2:c.1664_1714delTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAG
+#157:4493 NM_000222.2:c.1669_1680delinsGTTGTG
+#158:4478 NM_000222.2:c.1671_1709delinsTAAACATTTATCTCCTCAACAACCTTC
+#159:4471 NM_000222.2:c.1674_1695delinsT
+#158:5285 KIT:p.V559D
+#157:4499 NM_000222.2:c.1679_1720delTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAA
+#159:4476 NM_000222.2:c.1705_1728delGTTTACATAGACCCAACACAACTT
+#157:4502 NM_000222.2:c.1717_1758dupCCAACACAACTTCCTTATGATCACAAATGGGAGTTTCCCAGA
+#159:4479 NM_000222.2:c.1738_1739insCCCTTATGATCC
+#157:5307 KIT:p.T670I
+#160:1923 KIT:p.D816Y
+#159:4485 MEN1:p.D423N
+#158:4495 MEN1:p.T202I
+#157:4513 NM_000245.2:c.3213delT
+#158:4499 NM_000249.3:c.1011dupC
+#157:4517 NM_000249.3:c.117-2A>G
+#158:4502 NM_000249.3:c.1336_1337dupAG
+#157:4520 NM_000249.3:c.1554dupT
+#159:4497 MLH1:p.S577=
+#159:4499 NM_000249.3:c.1852_1854delAAG
+#157:1943 MLH1:p.P648S
+#160:4499 NM_000249.3:c.1990-1G>C
+#160:4501 NM_000249.3:c.2092_2093delTC
+#158:578 MLH1:p.W714*
+#159:4508 MLH1:p.A111V
+#157:4534 MLH1:p.S131*
+#157:4535 NM_000249.3:c.503dupA
+#158:237 MLH1:p.R226*
+#157:4538 NM_000249.3:c.678-2A>G
+#158:1040 MLH1:p.R265S
+#159:4517 NM_000251.2:c.1018dupA
+#158:3380 MSH2:p.R389*
+#159:4520 NM_000251.2:c.1226_1227delAG
+#157:4546 MSH2:p.L458*
+#158:1573 MSH2:p.Y522*
+#159:4525 NM_000251.2:c.1705_1706delGA
+#158:4535 NM_000251.2:c.186_187dupGG
+#160:4525 NM_000251.2:c.1986_1987delGA
+#160:4527 MSH2:p.C697F
+#159:4532 NM_000251.2:c.2135dupT
+#157:4558 NM_000251.2:c.2327_2328delinsA
+#160:2487 MSH2:p.E859*
+#157:4561 NM_000251.2:c.400delA
+#159:4538 NM_000251.2:c.567_587delTCTCCTCATCCAGATTGGACC
+#157:4564 NM_000251.2:c.839dupT
+#159:4541 NM_000251.2:c.942+2_942+5delTAAA
+#159:4543 MSH6:p.Q4*
+#159:831 MSH6:p.R495*
+#159:4546 MSH6:p.E645*
+#157:4572 MSH6:p.G74*
+#158:4558 MSH6:p.Y850*
+#158:4560 NM_000179.2:c.2920delA
+#159:4554 MSH6:p.E1022*
+#160:4553 NM_000179.2:c.3155_3156delAG
+#158:4566 NM_000179.2:c.3238_3239delCT
+#159:4559 NM_000179.2:c.3268_3274delGAGCTTA
+#160:4557 NM_000179.2:c.3332_3335dupATGA
+#160:4558 NM_000179.2:c.3510_3511insAAT
+#158:4571 MSH6:p.S1180*
+#157:4589 NM_000179.2:c.3804dupA
+#158:4574 NM_000179.2:c.3939_3957dupTCAAAAGGGACATAGAAAA
+#158:4575 NM_000179.2:c.3996_4000dupATTTC
+#157:4593 MSH6:p.R174*
+#159:4570 NM_000179.2:c.698dupC
+#159:4572 MUTYH:p.Q338*
+#157:2853 MUTYH:p.P405L
+#157:144 MUTYH:p.Y179C
+#159:4579 MUTYH:p.Q267*
+#159:4581 NM_002485.4:c.156_157delTT
+#159:4582 NM_001042492.2:c.1030delC
+#160:4581 NM_001042492.2:c.1521delG
+#158:4595 NF1:p.S575*
+#158:4597 NM_001042492.2:c.2226delC
+#157:4616 NF1:p.Q912*
+#158:4602 NF1:p.Q1101*
+#159:4596 NF1:p.Q1188*
+#160:2458 NF1:p.Q1341*
+#157:4626 NF1:p.E1550*
+#160:4601 NF1:p.K1738*
+#159:4607 NF1:p.E1929*
+#159:1697 NF1:p.Q209*
+#158:4620 NM_001042492.2:c.6852_6855delTTAC
+#159:4614 NM_001042492.2:c.7548_7549delinsTT
+#158:4624 NM_001042492.2:c.7819delG
+#157:4643 NF1:p.W2712*
+#158:4628 NM_024675.3:c.12dupT
+#157:4646 NM_024675.3:c.1671_1674delTATT
+#160:4620 PALB2:p.L703*
+#158:4633 NM_024675.3:c.229delT
+#160:4623 NM_024675.3:c.2406_2407delTG
+#159:4628 NM_024675.3:c.2813delA
+#157:4655 NM_024675.3:c.3246_3247delTG
+#157:4657 NM_024675.3:c.393_423delGGTCAGTGACCCTAGTGGTGAGCAAAAGCAG
+#159:4634 NM_006206.4:c.13delC
+#160:4633 PMS2:p.Q346*
+#158:2876 PMS2:p.S46I
+#159:4640 NM_000535.5:c.164-1G>A
+#160:4639 PMS2:p.R628*
+#158:4652 NM_000535.5:c.2175_2275delACCTCAGACTCTCAACTTAACTGCTGTTAATGAAGCTGTTCTGATAGAAAATCTGGAAATATTTAGAAAGAATGGCTTTGATTTTGTTATCGATGAAAATG
+#159:4645 NM_000535.5:c.2445+1G>T
+#159:4647 NM_000535.5:c.534delG
+#157:4673 NM_000535.5:c.804_903delCATCTCAGGTTTCATTTCACAATGCACGCATGGAGTTGGAAGGAGTTCAACAGACAGACAGTTTTTCTTTATCAACCGGCGGCCTTGTGACCCAGCAAAG
+#160:4647 NM_000264.3:c.-8456delG
+#160:4649 PTEN:p.Y68*
+#159:1981 PTEN:p.R130*
+#157:4681 NM_000314.4:c.481delA
+#160:611 PTEN:p.Q214*
+#157:4686 NM_000314.4:c.802-2A>T
+#158:4672 NM_000314.4:c.932dupA
+#160:2888 PTPN11:p.E76K
+#160:4665 RAD51C:p.R193*
+#158:4678 RAD51D:p.Q160*
+#158:4679 NM_000321.2:c.2525_2526delCT
+#158:4681 RET:p.C618S
+#158:4683 RET:p.C620F
+#158:4685 RET:p.K666N
+#159:1993 RET:p.M918T
+#160:4677 NM_001754.4:c.292delC
+#157:4707 NM_001754.4:c.367delG
+#158:4693 NM_001754.4:c.431_440delinsCAAACG
+#160:2901 RUNX1:p.R204*
+#160:4686 SDHA:p.Q375*
+#160:3443 SDHA:p.R75*
+#160:4691 NM_003000.2:c.1_72delATGGCGGCGGTGGTCGCCCTCTCCTTGAGGCGCCGGTTGCCGGCCACAACCCTTGGCGGAGCCTGCCTGCAG
+#157:4720 SDHB:p.C98Y
+#160:1998 SDHB:p.R242H
+#160:4696 SDHD:p.R38*
+#160:4698 SDHD:p.L95P
+#157:4728 SDHD:p.M1I
+#160:4702 NM_005359.5:c.1233_1249delTTACTACTTAGACAGAG
+#157:3292 SMAD4:p.R445*
+#159:4710 SMAD4:p.S144L
+#158:4720 NM_005359.5:c.728_735delGGCCTCAG
+#159:4714 SMAD4:p.E33*
+#159:4716 STK11:p.Q37*
+#158:2477 STK11:p.E57*
+#159:4721 NM_000455.4:c.351delA
+#160:4720 STK11:p.C151*
+#157:4750 NM_000455.4:c.587delG
+#159:4728 STK11:p.E223*
+#159:4730 NM_000455.4:c.795delG
+#160:4729 TP53:p.E336*
+#160:3281 TP53:p.R342*
+#159:4737 NM_000546.5:c.102dupC
+#158:4747 NM_000546.5:c.147_150dupTATT
+#157:698 TP53:p.E68*
+#157:4768 NM_000546.5:c.239delC
+#158:622 TP53:p.W91*
+#158:4756 NM_000546.5:c.286dupT
+#158:4758 NM_000546.5:c.306delC
+#159:4752 TP53:p.Y107*
+#159:4754 TP53:p.C124*
+#159:4756 NM_000546.5:c.384_385delinsC
+#159:4758 TP53:p.C135*
+#160:4757 NM_000546.5:c.424_433delCCTGTGCAGC
+#158:4771 TP53:p.W146*
+#158:1118 TP53:p.P152L
+#159:4767 NM_000546.5:c.461delG
+#160:5280 TP53:p.R158H
+#159:2388 TP53:p.Q165*
+#157:4798 TP53:p.E171*
+#159:4776 TP53:p.S183*
+#159:4778 NM_000546.5:c.578_600delATCTTATCCGAGTGGAAGGAAAT
+#160:4777 TP53:p.E198*
+#157:4807 NM_000546.5:c.626_627delGA
+#157:4809 NM_000546.5:c.658_659insTCAA
+#158:4795 NM_000546.5:c.673-9_675delATCTCCTAGGTT
+#158:4797 TP53:p.Y234*
+#158:4799 NM_000546.5:c.723dupC
+#157:1115 TP53:p.G245C
+#159:1120 TP53:p.R248Q
+#160:4795 NM_000546.5:c.763delA
+#160:4797 TP53:p.G266*
+#158:4811 NM_000546.5:c.826_827delinsTTT
+#158:4813 TP53:p.E285*
+#160:4804 NM_000546.5:c.864delT
+#160:4806 NM_000546.5:c.874_877delAAAG
+#157:4836 TP53:p.E298*
+#157:4838 NM_000546.5:c.919+1G>T
+#159:4816 TP53:p.K319*
+#158:4826 NM_000546.5:c.986_992delCCCTTCA
+#158:4828 NM_000548.3:c.-1857G>T
+#159:4821 NM_000551.3:c.385_386dupCT
+#160:2051 VHL:p.R161*
+#158:4832 NM_024426.3:c.1301delG
+#159:4826 APC:p.E536*
+#157:4852 NM_000038.4:c.3880_3881delCA
+#159:4829 NM_000059.3:c.5297dupA
+#159:4830 NM_000077.4:c.205delG
+#158:4840 MSH2:p.K491*
+#160:4830 PTEN:p.Y76*
+#157:4859 NM_000455.4:c.824dupC
diff --git a/zzz.py b/zzz.py
new file mode 100644
index 0000000..10e374e
--- /dev/null
+++ b/zzz.py
@@ -0,0 +1,5 @@
+import subprocess
+
+p = subprocess.Popen("ls -lh", stdout=subprocess.PIPE, shell=True)
+
+print(p.communicate())
\ No newline at end of file
diff --git a/zzzz b/zzzz
new file mode 100644
index 0000000..65da50e
--- /dev/null
+++ b/zzzz
@@ -0,0 +1,38 @@
+"structural variant",
+ "insertion",
+ "in-frame insertion",
+ "deletion",
+ "deletion polymorphism",
+ "in-frame deletion",
+ "translocation",
+ "inverted translocation",
+ "inversion",
+ "indel",
+ "fusion",
+ "out-of-frame fusion",
+ "oncogenic fusion",
+ "in-frame fusion",
+ "disruptive fusion",
+ "duplication",
+ "internal duplication",
+ "tandem duplication",
+ "internal tandem duplication",
+ "itd",
+ "domain duplication",
+ "kinase domain duplication",
+ "copy variant",
+ "copy number variation",
+ "copy number variant",
+ "copy loss",
+ "copy number loss",
+ "shallow deletion",
+ "deep deletion",
+ "gene deletion",
+ "copy gain",
+ "copy number gain",
+ "low level copy gain",
+ "amplification",
+ "focal amplification",
+ "rearrangement",
+
+